ID: 989776135

View in Genome Browser
Species Human (GRCh38)
Location 5:45208789-45208811
Sequence ATTAGCTGGACTGGATTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989776132_989776135 0 Left 989776132 5:45208766-45208788 CCAGGATCAAATTGGATTGGATA No data
Right 989776135 5:45208789-45208811 ATTAGCTGGACTGGATTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989776135 Original CRISPR ATTAGCTGGACTGGATTTAG AGG Intergenic
No off target data available for this crispr