ID: 989776136

View in Genome Browser
Species Human (GRCh38)
Location 5:45208796-45208818
Sequence GGACTGGATTTAGAGGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989776132_989776136 7 Left 989776132 5:45208766-45208788 CCAGGATCAAATTGGATTGGATA No data
Right 989776136 5:45208796-45208818 GGACTGGATTTAGAGGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989776136 Original CRISPR GGACTGGATTTAGAGGCCTC AGG Intergenic
No off target data available for this crispr