ID: 989776139

View in Genome Browser
Species Human (GRCh38)
Location 5:45208816-45208838
Sequence AGGTAGGTAACTTTTGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989776132_989776139 27 Left 989776132 5:45208766-45208788 CCAGGATCAAATTGGATTGGATA No data
Right 989776139 5:45208816-45208838 AGGTAGGTAACTTTTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989776139 Original CRISPR AGGTAGGTAACTTTTGAAAA TGG Intergenic
No off target data available for this crispr