ID: 989785012

View in Genome Browser
Species Human (GRCh38)
Location 5:45316591-45316613
Sequence GGGTATTCAATTACAAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14192
Summary {0: 4, 1: 87, 2: 7304, 3: 4142, 4: 2655}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989785009_989785012 8 Left 989785009 5:45316560-45316582 CCAGGGCAATCAGGCAGGAGAAA 0: 1404
1: 6333
2: 8242
3: 5226
4: 4230
Right 989785012 5:45316591-45316613 GGGTATTCAATTACAAAAAGAGG 0: 4
1: 87
2: 7304
3: 4142
4: 2655

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989785012 Original CRISPR GGGTATTCAATTACAAAAAG AGG Intronic
Too many off-targets to display for this crispr