ID: 989786534

View in Genome Browser
Species Human (GRCh38)
Location 5:45338740-45338762
Sequence CACTGTGACTTGAATGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989786534 Original CRISPR CACTGTGACTTGAATGTAGT AGG Intronic
902123681 1:14190214-14190236 CACTGTGACTTTCAGGTTGTTGG - Intergenic
902411940 1:16216968-16216990 CACTGTGCCTGGCATGTTGTAGG - Intergenic
902947632 1:19853613-19853635 CACAGTGTCTGGCATGTAGTTGG + Intergenic
903819084 1:26087417-26087439 AACTGTGCCTGGCATGTAGTAGG - Intergenic
904641311 1:31932534-31932556 TTATGTGACTTGAATGTAGACGG - Intronic
905226347 1:36481621-36481643 CCCTGTGCCTTGCATGGAGTTGG + Intronic
905382346 1:37571942-37571964 CACTGTGGCTGGAATGTCGTGGG - Intronic
905865481 1:41374132-41374154 CACTGTCACATGGATGAAGTTGG + Intronic
906728995 1:48064977-48064999 CACTGTGCCTAGCATGTAGTAGG - Intergenic
906855178 1:49296651-49296673 CCCTGTGAGTTGCCTGTAGTGGG + Intronic
907470137 1:54668490-54668512 CAATCTGACTTGTATGTACTGGG + Intronic
908107351 1:60858691-60858713 GTCTGTGACTTGAACATAGTAGG + Intergenic
909212924 1:72847042-72847064 TACTGTGACTTGAATGAAGCTGG + Intergenic
911731736 1:101298631-101298653 CACTGTGCCTTGCATGCAGTAGG + Intergenic
912273560 1:108233593-108233615 CACTGAAACTAGAATGTAGGAGG + Intronic
912294660 1:108460729-108460751 CACTGAAACTAGAATGTAGGAGG - Intronic
912438948 1:109683575-109683597 CATAGTGCCTGGAATGTAGTAGG + Intronic
912441470 1:109702020-109702042 CATAGTGCCTGGAATGTAGTAGG + Intronic
915576401 1:156781244-156781266 CACAGTGTCTTGAATATAATAGG + Intronic
916506235 1:165430294-165430316 GACAGTGCCTTGCATGTAGTAGG - Intronic
916582904 1:166124233-166124255 AACTGTGAATTGAATGTGGAAGG - Intronic
917008446 1:170443348-170443370 CACAGTGTCTAGCATGTAGTAGG - Intergenic
917078804 1:171235756-171235778 CACAGTGCCTGGCATGTAGTAGG - Intergenic
917163839 1:172089022-172089044 CACAGTGACTTGTGTGTAGTAGG + Intronic
918158838 1:181878126-181878148 CACAGTGACTTGAATGAGATTGG + Intergenic
918527572 1:185481590-185481612 GGCTTTGACTTGTATGTAGTGGG - Intergenic
918576374 1:186065615-186065637 CACTGTGCCTAGAACATAGTAGG - Intronic
919758495 1:201081359-201081381 CAGTGTTACTTGTTTGTAGTGGG + Intronic
920261049 1:204688221-204688243 CACCTTGCCTTGCATGTAGTAGG - Intergenic
920894617 1:210033750-210033772 CATTGTGCCTTGATTTTAGTAGG + Intronic
923170610 1:231413457-231413479 AATAGTGACTTGAATGAAGTGGG - Intronic
923275541 1:232392467-232392489 TACAGTGACTTGGATGAAGTTGG + Intergenic
1064063539 10:12160718-12160740 CACAGTGTCTTGCATGTAATAGG + Intronic
1066249443 10:33618593-33618615 GACTGTGACTTGAAGGTTGTAGG - Intergenic
1066512138 10:36112451-36112473 AACTGTGACTGGCATATAGTAGG - Intergenic
1069171174 10:65231339-65231361 CAGTGTGACATGAATCTTGTTGG - Intergenic
1070702112 10:78611611-78611633 CACTTAGCCTTGAATGTAGGAGG + Intergenic
1073043140 10:100621039-100621061 CACAGTGCCTGGTATGTAGTAGG - Intergenic
1076423085 10:130346580-130346602 CACTGTGAGTTGCATCTTGTAGG + Intergenic
1077962978 11:7095042-7095064 CACAGTGCCTGGAATGCAGTGGG + Intergenic
1078605378 11:12770457-12770479 CACTGTGCTTTGAATGTGATGGG + Intronic
1080744883 11:35099996-35100018 CCCTGTGGCTTGAAGGTAGTGGG + Intergenic
1080761960 11:35259510-35259532 CACAGTGCCTTGCATGCAGTAGG - Exonic
1080915613 11:36655509-36655531 CACAGTGACTAGAATTTAATAGG + Intronic
1083439952 11:62669591-62669613 CACTGTGAGCTGAATGTTCTGGG - Intronic
1083795265 11:65013489-65013511 CACAGTGGCTGGCATGTAGTAGG - Intergenic
1084967756 11:72753211-72753233 CACTGGGACTAGCATGCAGTAGG - Intronic
1085361927 11:75896636-75896658 CACAGTGCCTGGTATGTAGTAGG + Intronic
1086615490 11:88813257-88813279 CCCTGTGACTTGCAGGTAGGGGG + Intronic
1089398537 11:118151424-118151446 CACAGTGACCTTAATGAAGTGGG - Intronic
1089412764 11:118260679-118260701 CACAGTGCCAGGAATGTAGTAGG - Intronic
1089741944 11:120590548-120590570 CACAGTGCCTGGAATGTAATTGG + Intronic
1089869615 11:121660490-121660512 CTATGTGACTGGAAGGTAGTAGG + Intergenic
1090990547 11:131813331-131813353 CAGTGTGCCTTGAACTTAGTAGG - Intronic
1091574647 12:1721878-1721900 CAGTGTGGCTGGAATGTAATGGG + Intronic
1093258191 12:16899184-16899206 CATTGTGTCTTGCATGTAATGGG + Intergenic
1095630142 12:44366811-44366833 CACTGTGTCTTGAATGTAGCAGG - Intronic
1095684088 12:45012526-45012548 CACTGTGGCCTGAATGGAGGAGG + Intergenic
1099037043 12:77601545-77601567 TAATGGGACTTCAATGTAGTAGG + Intergenic
1099426481 12:82530187-82530209 CAATGTTACTGGAATCTAGTGGG - Intergenic
1101092772 12:101304651-101304673 CACTGTTACTGGCATCTAGTGGG + Intronic
1103399303 12:120632081-120632103 CACGGTGGCTGGAATGTGGTGGG + Intergenic
1104119244 12:125783213-125783235 AACAGTGACTAGCATGTAGTAGG + Intergenic
1105060565 12:133146539-133146561 CTCTGTATCTTGAATGAAGTGGG - Intronic
1105884738 13:24632035-24632057 GAATGAGACTTGAATATAGTAGG - Intergenic
1106315818 13:28592311-28592333 CACGGAGACTTCAAGGTAGTGGG - Intergenic
1108193619 13:47969381-47969403 CACAGTGCCTGGAATGTAATAGG - Intronic
1108599472 13:51979523-51979545 AACAGTGACTTGATTGTAGTTGG + Intronic
1110823438 13:79943570-79943592 CCCTGTGACTAGCATGAAGTGGG - Intergenic
1111564676 13:89999355-89999377 CACTGTACCTTGAATTTACTTGG - Intergenic
1114447026 14:22796500-22796522 CACAGTGAATTGCATGTAGTGGG - Intronic
1114718474 14:24854029-24854051 CACAGTGACTAGCATGTAGTAGG + Intronic
1117378843 14:55139733-55139755 CACAGTACCTTGAATGTAGTTGG + Intronic
1119282897 14:73425687-73425709 AACAGTGCCTTGAATATAGTAGG - Intronic
1119855191 14:77894631-77894653 CACAGTGCCTGGCATGTAGTAGG + Intronic
1124203328 15:27697050-27697072 CACTGGGACATGAAGGTAGGTGG - Intergenic
1125008766 15:34847718-34847740 CACTTTTACTTGATTATAGTGGG - Intergenic
1126438144 15:48656985-48657007 CACTGAGACTTGAATTTGGTTGG + Intergenic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1126886700 15:53158617-53158639 CACAGTGCCTTGAATCTAGTAGG + Intergenic
1127736813 15:61848669-61848691 CACTGTGAATTGAATGAAGTGGG + Intergenic
1129824167 15:78623892-78623914 CACAGTGCCTGGCATGTAGTAGG - Intergenic
1131412015 15:92215992-92216014 CACAGTGACTTGATTTTTGTAGG - Intergenic
1131986886 15:98051725-98051747 CTCTGTGCCTATAATGTAGTAGG - Intergenic
1132112496 15:99112529-99112551 CTGTGTGACTTGTATGTGGTGGG + Intronic
1133404115 16:5509469-5509491 CACTGTGGCTGGCTTGTAGTTGG + Intergenic
1134223782 16:12375990-12376012 CACCCAGACTGGAATGTAGTGGG - Intronic
1137344600 16:47644382-47644404 CACTGTGCCTAGTATGTAGCTGG - Intronic
1137345213 16:47651423-47651445 TACTGTGTCTTGAATTTTGTGGG + Intronic
1137612758 16:49829899-49829921 CACAGTGCCTGGCATGTAGTTGG - Intronic
1139278730 16:65751384-65751406 CAGAGTGACTTGAATGCATTTGG - Intergenic
1140863128 16:79036617-79036639 CACTGTGAATTGAATGGAGTTGG - Intronic
1141008076 16:80371792-80371814 CACAGTGCCTGGAATGCAGTGGG + Intergenic
1142490842 17:278430-278452 CAGTGTGACTTGAGTTAAGTTGG - Intronic
1142932265 17:3296889-3296911 CAATGTTACTTGACTGTACTGGG + Intergenic
1144181972 17:12760795-12760817 CACTGTGAGTTGGATGTACCAGG + Intronic
1144347427 17:14362048-14362070 CACAGTGACTAGAATATAGTAGG + Intergenic
1146470667 17:33121756-33121778 CACAGTGCCTGGCATGTAGTAGG - Intronic
1147477285 17:40724241-40724263 AAAAGTGACTTGCATGTAGTAGG + Intergenic
1149649897 17:58270156-58270178 TACAGTGCCTTGCATGTAGTAGG + Exonic
1149694453 17:58605601-58605623 CCCTGTGACTTGAGTGGAGTGGG - Intronic
1153644795 18:7185598-7185620 GACTGTGCCTGGAATATAGTTGG + Intergenic
1154115402 18:11609511-11609533 CACTGTGACCTCATTGGAGTTGG - Intergenic
1155056515 18:22188501-22188523 CATTGTGACTGGAGTGTAGGGGG + Intronic
1155820438 18:30368954-30368976 CACTGTGACTGGAAGATAGAGGG - Intergenic
1158130015 18:54142165-54142187 CCCTGTGACCTGAAGGTATTGGG + Intergenic
1158519328 18:58158035-58158057 CACAGTGACTGGTATGTAGCAGG + Intronic
1158724395 18:59956311-59956333 CACTGGGAATTGGATGTAGATGG + Intergenic
925442643 2:3901548-3901570 CACTTTTACTTGAAAGTACTCGG + Intergenic
927702177 2:25275691-25275713 CACTGTGCCTGGCATGTGGTGGG - Intronic
927793044 2:26025876-26025898 CCCAGTGTCTTGCATGTAGTGGG - Intergenic
929904705 2:46035815-46035837 GACTGTGCCTTGCATGTAGCAGG - Intronic
930225517 2:48788497-48788519 CACACTGCCTTGCATGTAGTAGG + Intergenic
930391246 2:50764189-50764211 CACAGTGTCTGGCATGTAGTAGG - Intronic
930774086 2:55155533-55155555 CAGCGTGACTTGAACATAGTAGG + Intergenic
932225440 2:70036193-70036215 CCCTGTTACTTGAATATGGTGGG + Intergenic
932559689 2:72856167-72856189 CACAGTGACCAGCATGTAGTAGG + Intergenic
932686233 2:73872727-73872749 CTGTGGGACTTGAATTTAGTAGG - Intronic
933500879 2:83109654-83109676 CCCTGTGCCTTGCATGTAATAGG + Intergenic
933582990 2:84148392-84148414 TACTGTTACCTTAATGTAGTGGG + Intergenic
933840597 2:86283100-86283122 CACTGTGCTATGAGTGTAGTGGG - Intronic
934056438 2:88254965-88254987 CACATTGACTGGCATGTAGTAGG + Intergenic
935315563 2:101830281-101830303 CATTGTGACTTCATTGTAGTAGG + Intronic
939270495 2:139932288-139932310 AAGTCTGACTTGAATTTAGTAGG + Intergenic
941480737 2:166007171-166007193 CACTGTGACTTATGTGTAGTGGG - Intronic
942808082 2:179958716-179958738 AATTTTGACTTGAATATAGTAGG - Intronic
942817459 2:180069026-180069048 TTCTGTGACTTGAATTTATTTGG + Intergenic
943754035 2:191539616-191539638 CACTGTGCCTTGACTGGTGTTGG + Intergenic
944537458 2:200725339-200725361 CACTGTGTCTTGCATGTTTTAGG - Intergenic
946145752 2:217729680-217729702 CATTGTGACTTGAAGGCAGCAGG - Intronic
947078978 2:226374562-226374584 CACAATGACTAGAATATAGTAGG + Intergenic
947121612 2:226821118-226821140 CTCTGTGACTGGAACATAGTAGG - Intergenic
948447087 2:238041089-238041111 CACTGTGTCTTGCGTGCAGTAGG + Intronic
1168882050 20:1215461-1215483 CACTGTGACATGAAGGTACAGGG - Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169898107 20:10525767-10525789 CGCTGAGCCTTGAATGCAGTTGG - Intronic
1172929834 20:38578420-38578442 CACAGTGCCTTGCATATAGTAGG + Exonic
1174459513 20:50672719-50672741 CACTGTGACGTGCATGCAGGTGG - Intronic
1175591007 20:60191951-60191973 CACTGGGATTTGAATCTAGGTGG + Intergenic
1177592829 21:23194476-23194498 CACTGTAACTTGAGTGTAGAGGG - Intergenic
1178093613 21:29190348-29190370 CACAGTGTCTTAAATGTTGTTGG - Intergenic
1179363608 21:40735551-40735573 CAGTGTGTCTGGAATGTAGGTGG - Intronic
1180578786 22:16809532-16809554 CACTGTGACTTCACTGTTGTGGG - Intronic
1182060090 22:27390921-27390943 AACAGTGACTGGAATGTAATAGG - Intergenic
1182571212 22:31239763-31239785 CAAAGTGCCTAGAATGTAGTGGG + Intronic
1183313048 22:37121805-37121827 CACCGTGACTTGCAGGTACTAGG + Intergenic
1183789517 22:40054659-40054681 CACTGTGAGTTGCACATAGTAGG + Intronic
1184093140 22:42302730-42302752 GTCTGTGATTTGAGTGTAGTGGG - Intronic
952030844 3:29141077-29141099 CACTCTGCCTTGAAGGGAGTAGG + Intergenic
952543936 3:34398005-34398027 TACTGGGCCTGGAATGTAGTTGG - Intergenic
954419553 3:50411453-50411475 CACTGTGTCTGGAATGGAGCTGG - Intronic
954518159 3:51198448-51198470 CTCTTTGACTTGAAGTTAGTGGG - Intronic
954762248 3:52884205-52884227 TACTGTATCTTGATTGTAGTAGG - Intronic
956000175 3:64721578-64721600 CACAGTGCCAAGAATGTAGTAGG + Intergenic
956212148 3:66813181-66813203 CACAGTGTCTTCCATGTAGTAGG + Intergenic
956711593 3:72042856-72042878 TACTGTGACTTCAGGGTAGTGGG - Intergenic
956711863 3:72046069-72046091 TACTGTGACTTCAGGGTAGTGGG - Intergenic
956904408 3:73750736-73750758 CACTGTGACTTGCACATAGAAGG - Intergenic
957798505 3:85043636-85043658 CACCCAGACTTGAGTGTAGTAGG - Intronic
961465193 3:127077111-127077133 TGCTGTGAGTTGAATGTTGTTGG - Intergenic
963278977 3:143362713-143362735 CACTGTAAATTGAATGTGTTGGG - Intronic
965111039 3:164423242-164423264 CACTGTGTATTGAATACAGTAGG - Intergenic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
967641493 3:191870100-191870122 CACTGTGGTTTGAATTTATTGGG + Intergenic
967852997 3:194096099-194096121 CACAGTGACTGGAATATAGTAGG - Intergenic
972275492 4:37553803-37553825 CACAGTGACTTGCATATAGGTGG - Intronic
975938526 4:79611673-79611695 CACTGTGATTTAACTGTAATTGG - Intergenic
978730591 4:112021944-112021966 CACAGTGACTGCAATATAGTAGG + Intergenic
980995304 4:139774383-139774405 CACTGTGGCTGGCACGTAGTAGG + Intronic
982834361 4:160105171-160105193 CACTGTGGCTTAAACATAGTAGG + Intergenic
983971782 4:173884099-173884121 GACTGTGCCTTGAATGCAGTAGG + Intergenic
987972816 5:24971938-24971960 CTATGTGCCTTGAATGTAGAAGG + Intergenic
988229644 5:28458687-28458709 CACTTCATCTTGAATGTAGTTGG + Intergenic
988994855 5:36705136-36705158 CACTGTGACTGAAATTTAGCAGG + Intergenic
989003013 5:36780988-36781010 CACAGTGACTGGAACATAGTAGG - Intergenic
989786534 5:45338740-45338762 CACTGTGACTTGAATGTAGTAGG + Intronic
990111346 5:52329097-52329119 ACCTGTGACTGGAATTTAGTAGG - Intergenic
991598432 5:68328180-68328202 CACTGTGAATTAAAGGCAGTGGG - Intergenic
993151209 5:84164701-84164723 AATTGTGATTTGCATGTAGTAGG - Intronic
993307014 5:86286493-86286515 CACTGAAACTAGAATGTAGGAGG - Intergenic
996742847 5:126817540-126817562 GTCTCTGACTTGAATCTAGTAGG + Intronic
998223051 5:140303554-140303576 CACTGTGCCTAGAATGTCTTTGG - Intergenic
999980463 5:156952827-156952849 CACAGTGTCTTGCATATAGTAGG + Intronic
1000692275 5:164338410-164338432 CAGTGTGACTAGCATTTAGTAGG + Intergenic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002113280 5:176936200-176936222 CATTGTGACTAGCATGTAATAGG - Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1002655668 5:180744719-180744741 AGCTGTGACTTGAATCAAGTGGG - Intergenic
1004744208 6:18493650-18493672 CACTGTGTCCTGAATGAAATAGG + Intergenic
1005407670 6:25507271-25507293 ATCTGTGACTTGAATGTTCTTGG + Intronic
1006756710 6:36422599-36422621 CACAGTGCCTGGAATATAGTAGG + Intronic
1007462417 6:42028121-42028143 CACTGTGCCTAGCATGTGGTAGG + Intronic
1008372048 6:50743982-50744004 CACTGTGCCTTGAATAAGGTAGG + Intronic
1008894819 6:56540834-56540856 CACTTTGACATGAAAGCAGTGGG + Intronic
1009918424 6:70025455-70025477 CACTGTGCCTTACATGTAGCAGG - Intronic
1011644042 6:89441100-89441122 CACTGTTACTTCACTATAGTGGG + Intronic
1012291466 6:97460545-97460567 CACAGTGCCTGGCATGTAGTAGG + Intergenic
1015041155 6:128720827-128720849 CACTTTAAATTGTATGTAGTGGG - Intergenic
1015262198 6:131250891-131250913 AACTCTGACTCTAATGTAGTGGG - Intronic
1015511784 6:134044780-134044802 CACTGTGCCTCTCATGTAGTAGG + Intronic
1015635434 6:135269844-135269866 CTCTGGGAGTTGAGTGTAGTGGG + Intergenic
1017223821 6:151996757-151996779 CACAGTAAATTGAATGTAATAGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017276533 6:152575817-152575839 CACAGTGCCTGGAATGTAATAGG + Intronic
1019102654 6:169643887-169643909 CAGTGTGACTTGTATGAACTGGG - Intronic
1019886857 7:3912908-3912930 AACTGTGACTTGCATCTCGTGGG - Intronic
1020377696 7:7506760-7506782 CACTGCTACTATAATGTAGTTGG - Intronic
1021706344 7:23371910-23371932 CACTGTGACTTCAGTGTGGCTGG - Intronic
1021791586 7:24211276-24211298 CACTCTGCCTTGAATGTTTTGGG + Intergenic
1022055487 7:26728949-26728971 CAATGTAACTTGAATGCAGGTGG + Intronic
1024380755 7:48693739-48693761 TACTCTGACTGGAATGTAGTAGG - Intergenic
1024399387 7:48906425-48906447 CACTGTGTCTTGCATATGGTAGG + Intergenic
1026557273 7:71419534-71419556 CATTGTGACTTGAATAAGGTGGG + Intronic
1029624600 7:101712628-101712650 CACAGTGCCTTGCACGTAGTAGG - Intergenic
1029781150 7:102735098-102735120 CACTGTGACTTCAATCTCCTGGG + Intergenic
1030528449 7:110681640-110681662 CAGTGTGCTTTGCATGTAGTAGG - Intronic
1030651532 7:112121079-112121101 CACTGTGTCTGGCATATAGTAGG - Intronic
1031873890 7:127116393-127116415 CACCGTGTCTGGCATGTAGTGGG - Intronic
1032136733 7:129286086-129286108 CACTGTGACCTAAAACTAGTTGG - Intronic
1032443101 7:131957496-131957518 CAGTGGCAATTGAATGTAGTGGG - Intergenic
1032674008 7:134111415-134111437 CACTGTTACTTGAAGGTAAGTGG + Intergenic
1032730623 7:134638635-134638657 CACAGTGACTTGTTTATAGTAGG + Intergenic
1032756561 7:134896472-134896494 CACTGTGCTTTGCATGTATTGGG + Intronic
1033719042 7:144037439-144037461 CACTGTGCCTAGAATATTGTAGG + Intergenic
1033805367 7:144947909-144947931 CTCAGTAACTTGAATCTAGTAGG + Intergenic
1033955337 7:146841130-146841152 CCCAGAGACTTGAATTTAGTTGG + Intronic
1034033728 7:147798123-147798145 CACTGTGACAACAATGTATTTGG - Intronic
1038069984 8:24003203-24003225 TACTATGTCTTGAATATAGTTGG + Intergenic
1038291367 8:26252628-26252650 CACTGTGCCTGGCCTGTAGTGGG - Intergenic
1038964195 8:32552880-32552902 CACAGTGCCTGGCATGTAGTAGG - Intronic
1039665443 8:39522372-39522394 CACTGTGACATGAATACACTGGG - Intergenic
1039928925 8:41965043-41965065 CAGTGTGACTTGCATGTAGTAGG - Intronic
1040489512 8:47906590-47906612 CACTGTGTCTGGAGTGCAGTGGG - Intronic
1041966890 8:63688508-63688530 CACTGTTATTTGGATGTAATTGG + Intergenic
1045970505 8:108074849-108074871 CACTGTCCTTTGAATGAAGTGGG - Intronic
1046969745 8:120208950-120208972 CATAGTGACTTGCATGTAATAGG - Intronic
1048185006 8:132231925-132231947 CACAGTGCCTGGAATGTTGTGGG - Intronic
1051090466 9:13401530-13401552 CTGTGTGACTTGAATATACTGGG - Intergenic
1051093167 9:13434061-13434083 CCCAGAGACTTGAATGTAATTGG - Intergenic
1052213762 9:25939600-25939622 CACTGTGAATTGAATGTATTTGG - Intergenic
1054963323 9:70993948-70993970 CTCTGTGACATGAATGTCATTGG - Intronic
1055792148 9:79934492-79934514 CACTTTGACTGAAATGTAGATGG + Intergenic
1056210534 9:84360936-84360958 CACAGTGCCTGGAATATAGTAGG + Intergenic
1059674225 9:116522360-116522382 CACAGTGACTTGGATGGAATTGG + Intronic
1059741994 9:117160680-117160702 AACACTGACTAGAATGTAGTAGG + Intronic
1059975671 9:119714211-119714233 CACTGTTACTTGATAGTAGTTGG + Intergenic
1060014287 9:120073016-120073038 AACTGTGCCTGGCATGTAGTGGG - Intergenic
1060461967 9:123864886-123864908 AACAGTGACTGGAATGTAGTAGG - Intronic
1061863005 9:133477525-133477547 TTCTGTGACTTGAAGGTACTGGG + Intronic
1062100301 9:134724520-134724542 CACTGAGACTTGGATGGAGCGGG - Intronic
1186036362 X:5427836-5427858 CACAGTGACTTGTACATAGTAGG - Intergenic
1186126595 X:6420899-6420921 CATTCTGTCTTGAATGCAGTAGG + Intergenic
1187568529 X:20477018-20477040 TTCTGTGTCTTGATTGTAGTGGG + Intergenic
1193701765 X:84771531-84771553 CACAGTGCCTTGCATATAGTAGG - Intergenic
1195087922 X:101430172-101430194 CACTGTTATTTCTATGTAGTAGG - Intronic
1195621559 X:106961173-106961195 CACAGTGACTGGCATATAGTAGG - Intronic
1197853810 X:130893366-130893388 CACAGTGTCTTGCATATAGTAGG - Intronic
1199267258 X:145843214-145843236 CCCTGTGACTTGTATGTAATCGG - Intergenic
1200554518 Y:4618881-4618903 CACTGTGATTTGAGTGTGCTAGG - Intergenic
1201695691 Y:16822794-16822816 CAATGTGACTTGAGGGGAGTAGG - Intergenic
1202329168 Y:23728355-23728377 GACTGTGACTTCATTGTTGTGGG - Intergenic
1202541603 Y:25941699-25941721 GACTGTGACTTCATTGTTGTGGG + Intergenic