ID: 989792169

View in Genome Browser
Species Human (GRCh38)
Location 5:45419063-45419085
Sequence CCAAGTTCCTGAAAGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989792169_989792174 6 Left 989792169 5:45419063-45419085 CCTGGACACTTTCAGGAACTTGG 0: 1
1: 1
2: 0
3: 20
4: 136
Right 989792174 5:45419092-45419114 CTTTGGGAAAGCTCAGCATGTGG No data
989792169_989792173 -10 Left 989792169 5:45419063-45419085 CCTGGACACTTTCAGGAACTTGG 0: 1
1: 1
2: 0
3: 20
4: 136
Right 989792173 5:45419076-45419098 AGGAACTTGGGATGAACTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989792169 Original CRISPR CCAAGTTCCTGAAAGTGTCC AGG (reversed) Intronic
900839629 1:5037843-5037865 CCCAGTCCATGAAAGTGTCATGG + Intergenic
902430445 1:16359022-16359044 CCAAGGTGCTGAAATTGTGCTGG + Intronic
902710294 1:18234755-18234777 CCAAGTTCGTGAAAGGGACTCGG - Intronic
906562660 1:46770525-46770547 CCTTGGTCCTGAAAGTGTCAGGG - Intronic
907582406 1:55584018-55584040 TCAAGTTCCTGTAATTGCCCAGG - Intergenic
909529223 1:76662891-76662913 TGAGGTTCCTTAAAGTGTCCTGG - Intergenic
913059497 1:115191843-115191865 CCAAGTTCCTTGATTTGTCCTGG + Intergenic
913061096 1:115208845-115208867 CCATGTTCTTGCAAGTGGCCTGG - Intergenic
915873164 1:159583876-159583898 CCAAGTCAGTGTAAGTGTCCAGG - Intergenic
915977153 1:160399027-160399049 CCAAGTCCCTGCATGCGTCCAGG - Intergenic
916068249 1:161153692-161153714 CCAAGTTTGGGAAGGTGTCCGGG + Intronic
918756811 1:188348303-188348325 CCTAGTTCTTGATAGAGTCCAGG - Intergenic
922047735 1:221963046-221963068 CCAAGTTCCAGAAAGTGTAGGGG + Intergenic
924941327 1:248814015-248814037 CCAAGCTCCTGAAAGGGGACTGG - Intronic
1064640201 10:17407759-17407781 ACAAGTTCTTAAAAGTCTCCTGG + Intronic
1067146674 10:43699214-43699236 GCAGGTTTCTGAAAGTGGCCTGG - Intergenic
1069227318 10:65959899-65959921 CCAAGATCCAGACAATGTCCTGG + Intronic
1070457477 10:76631644-76631666 CCAAGTTTTTGAAAATGTCATGG + Intergenic
1073068452 10:100778456-100778478 CCAACTGCCTGCAAGTGTTCAGG + Intronic
1074727674 10:116329610-116329632 CAAACTCCCTGAAAGTGTCTTGG - Intronic
1075914326 10:126154370-126154392 CCAAGTTCCTGGAAGGCTGCAGG + Intronic
1083719667 11:64598113-64598135 CCAAGGTCCTGGCAGTGGCCAGG + Intronic
1084055431 11:66628921-66628943 CCCAGCTCTTGAAAGTGACCTGG + Intronic
1085925621 11:81016657-81016679 CTGAGTTCCTGAATGTGTCAAGG - Intergenic
1088805480 11:113348275-113348297 CCAATGTCCTGGAAGTGACCTGG + Intronic
1089616991 11:119700341-119700363 CCTAGTTCGTGAAAGGGGCCTGG + Intronic
1098335067 12:69395777-69395799 TAAAGTTCCTGAAGGAGTCCTGG - Intergenic
1099042957 12:77678882-77678904 CCCAGTTCCTGAAAGCTTTCTGG + Intergenic
1101250381 12:102928554-102928576 CCAAGTCCCTGCAAGGGTCAGGG - Intronic
1101934020 12:109041305-109041327 CCAAGTTCCTGAAAGCTTGCTGG + Intronic
1105844051 13:24279590-24279612 TCAAGTTCCTGAAAGTGTCCAGG - Intronic
1106655842 13:31745229-31745251 CCAACTTTATGAAAATGTCCAGG - Intronic
1106660201 13:31791436-31791458 CCAAGCCCCTGAAAGTCTGCTGG + Intronic
1107038290 13:35923011-35923033 CCTTGTTCCTGAAAGTGACTTGG + Intronic
1109050606 13:57476570-57476592 CCAAGTTCCCGTAAGTGTCTTGG - Intergenic
1109739037 13:66527203-66527225 CCAAATTACTGTAAGTGTCAGGG + Intronic
1110960934 13:81625128-81625150 CAAAGTTCCAGAGAATGTCCTGG + Intergenic
1112033808 13:95479723-95479745 TCAAGTTCCTTAAGGTCTCCAGG - Intronic
1112783916 13:102930797-102930819 GCAAGTCCCTGAGAATGTCCCGG - Intergenic
1117309045 14:54503928-54503950 CCAAGTTCCTGAAACTCTCATGG - Intergenic
1118098545 14:62568287-62568309 ACAAGTACCTGAACTTGTCCTGG + Intergenic
1118249282 14:64143345-64143367 CAGAGTTCCTTAAGGTGTCCTGG + Intronic
1119905026 14:78293884-78293906 CCATGTACCTGGCAGTGTCCTGG + Intronic
1120530206 14:85622531-85622553 CCAAGGTCCTGAACAAGTCCGGG + Exonic
1124645833 15:31437022-31437044 CACACTTCATGAAAGTGTCCAGG - Intergenic
1125445997 15:39757085-39757107 ACAAGTGCCTGAAACTGTGCTGG + Intronic
1126736198 15:51734312-51734334 CCATGTTCCTCAAATTGGCCTGG - Intronic
1128558068 15:68645188-68645210 CCAAGTTCCGGAATGTCTACGGG + Exonic
1130330998 15:82922222-82922244 GCCAGTTCCTTAAAGTGTCCTGG - Intronic
1137066875 16:35855870-35855892 CCAAGTTCAAGAAATTGTTCAGG + Intergenic
1137637525 16:49999815-49999837 GAAATTTCCTGAAAGTGGCCAGG + Intergenic
1138105953 16:54287186-54287208 CTAAGCTGCTGAAAGTGGCCGGG - Intergenic
1139064052 16:63291137-63291159 CCAAATTCCTGAGAGTGGCATGG - Intergenic
1141232561 16:82183128-82183150 CTAAGTTCTGGAAAGTGTCCTGG - Intergenic
1143289784 17:5820096-5820118 CCAGGTTGCTGACATTGTCCAGG - Intronic
1146109790 17:30078330-30078352 CCAAGTTCTGGAAAGTGTTGTGG + Exonic
1148646755 17:49223813-49223835 CCAGGATCCTGAAATTCTCCTGG - Exonic
1152245500 17:79182914-79182936 CGAAGTTCCCCAAAGTGACCCGG + Intronic
1157113234 18:44840689-44840711 CCCAGTTCCTGAAACTGCCAAGG + Intronic
1159183313 18:64939075-64939097 CCCAGAGTCTGAAAGTGTCCAGG - Intergenic
1159673447 18:71251869-71251891 CCAAGTTCCTGAATTTGTGTGGG + Intergenic
1161088178 19:2344557-2344579 CCATGGTCCTGAAGGTGCCCAGG + Exonic
1161363373 19:3864039-3864061 CCCACTTCCTGAAACTCTCCAGG + Intronic
1161527889 19:4768838-4768860 CCAAGTTCGTTCAGGTGTCCTGG - Intergenic
1162349436 19:10139762-10139784 CAAAGTTCCTGACATTCTCCAGG + Exonic
1162382328 19:10338940-10338962 TCATGTTCCTGAAGGTGTCCAGG - Exonic
1163471915 19:17502187-17502209 CCTAGTTCAGGACAGTGTCCTGG + Intronic
1164544730 19:29150819-29150841 CCAAGTTCCCTTAAGTGGCCAGG - Intergenic
1165148936 19:33749866-33749888 CCCAGCTCATGAAAGGGTCCGGG + Intronic
1166048419 19:40243177-40243199 CCAATTTCCCTAAAGTGACCTGG + Intronic
926036439 2:9639546-9639568 CCAAGATCCTCAAAGCATCCAGG + Intergenic
926231508 2:11007735-11007757 CCATCATCCTGATAGTGTCCTGG + Intergenic
926976511 2:18521450-18521472 GCAAGTCCCTGAAAGTTTCCAGG + Intergenic
929230021 2:39549740-39549762 CCAAAGTCCTGGAAGTGTCCAGG + Intergenic
931651151 2:64470124-64470146 CCAAGCACCTGAATGGGTCCTGG + Intergenic
931657125 2:64519574-64519596 CCAACTTCAAGAAAGTGGCCTGG - Intergenic
933525048 2:83426609-83426631 CCAAGGTTCTGAAAGAGTCAAGG + Intergenic
933882060 2:86679280-86679302 CCAAGTTGCTGAAAGCTTCTGGG - Intronic
937503892 2:122514512-122514534 CCAAGTTCCCTAGGGTGTCCTGG + Intergenic
939925550 2:148169855-148169877 CTTTGTTCCTGAAAGTGACCTGG + Intronic
940568670 2:155402851-155402873 CTAAGTCCCTGTCAGTGTCCTGG - Intergenic
941680541 2:168393891-168393913 ACAAGTTCCTCAAATTTTCCAGG - Intergenic
942038492 2:172034579-172034601 TGAAGTTCCTGAAAGGATCCAGG + Intronic
942606259 2:177694341-177694363 ACAAGATCCTGCAAGTGTCAGGG + Intronic
942634298 2:177986184-177986206 CCACTTTCCTGAAGGTCTCCAGG - Intronic
944365480 2:198913937-198913959 CAGACTTCCTGAAAGTGTCTTGG - Intergenic
945278234 2:208010059-208010081 CCAAGTTGCTGATAGTGTAGTGG - Intronic
946043260 2:216800581-216800603 CCAAGATCCTGAAGGTATACGGG - Intergenic
946961242 2:224987990-224988012 CCAATATCCTGAAAGTGTAAAGG - Intronic
947226978 2:227849964-227849986 CCAAACTCCTCAATGTGTCCTGG - Intergenic
948853263 2:240718578-240718600 CCAGGCTCCTGAACTTGTCCAGG + Intronic
1173790290 20:45823851-45823873 CCAAGTTCCCCATAGTCTCCTGG - Intronic
1175006794 20:55692134-55692156 CCAAGTTCCTGAAAATCTGGGGG - Intergenic
1175859070 20:62140055-62140077 CCAATTTCCTGGAAGTTCCCAGG - Intronic
1176069961 20:63221124-63221146 AGAAGTTAATGAAAGTGTCCAGG + Intergenic
1177094613 21:16817564-16817586 CCAAGTGCATGATTGTGTCCAGG + Intergenic
950499973 3:13357611-13357633 CCAAGGTGCTGAGTGTGTCCAGG - Intronic
950586665 3:13897071-13897093 CCAAGTTCCCTAAAGCATCCCGG - Intergenic
951245542 3:20337326-20337348 CCAAGGGCCTGAAAATGACCTGG - Intergenic
951655920 3:25008380-25008402 CCAAGTTCCTGAAGGTGAGCAGG - Intergenic
952103338 3:30040344-30040366 ACTTGTTCCTGAAAGAGTCCTGG + Intergenic
952923601 3:38306065-38306087 TCAAGTTCCTGGAAGCATCCTGG - Exonic
954424238 3:50434948-50434970 GCTAGTTCCTGCAAGTGCCCTGG - Intronic
959757711 3:109918715-109918737 GTAAGTTCCTGAAAGTGACTTGG - Intergenic
960330779 3:116357966-116357988 CCAAGTTTCCTAAAGTTTCCTGG - Intronic
968494570 4:908207-908229 CCAAGTTACTCCAAGTGTGCTGG + Intronic
969212469 4:5698308-5698330 CCAAGATCCTGCAAGTTTCCAGG + Intronic
969459491 4:7321513-7321535 CCCAGTGCCAGAAAGAGTCCCGG - Intronic
969630794 4:8334852-8334874 CCAAGTTCCTGGAAATATCCAGG + Intergenic
969833190 4:9815516-9815538 CCAAGATCCTTAAAGTTCCCTGG + Intronic
975073191 4:70169586-70169608 TCTAGTTCATGAAAGTGACCTGG + Intronic
977294489 4:95195434-95195456 CCAGGATCCTGAAAGTATACAGG + Intronic
980656549 4:135794322-135794344 CCATGTTCCTGGAAGTGTAGTGG + Intergenic
983741401 4:171139066-171139088 CCCAGTTCCTGAAATAGTTCTGG + Intergenic
985531058 5:434060-434082 GCGAGTTCCTGAAAGTGCCCTGG - Exonic
989792169 5:45419063-45419085 CCAAGTTCCTGAAAGTGTCCAGG - Intronic
990528030 5:56647358-56647380 CCAAGTTCCTGAAGCTGTCTGGG - Intergenic
990749271 5:58995617-58995639 CCAAGTGCCAGAAAGTGAGCTGG - Intronic
992113759 5:73520029-73520051 CCAAGTGCCTTAAAGTGTTCTGG - Intergenic
992816572 5:80446599-80446621 CCAATTCCCTGAAAGTGTCTTGG + Intronic
995077907 5:108009469-108009491 CCAAGTGACTGAAAGTGACTTGG - Intronic
1001093308 5:168757385-168757407 CCAGGCTCCTGAAAGTGTCTGGG + Intronic
1001519530 5:172381313-172381335 CCAAGGTGCTGGGAGTGTCCTGG - Intronic
1006719044 6:36138380-36138402 CCCAGATCCTGAAAGTGACCGGG + Exonic
1010883358 6:81207466-81207488 CCAAGTTCCTAAAATTCTCTTGG - Intergenic
1015195656 6:130522376-130522398 CCAAGTTCTTGAAAGAGTTGTGG - Intergenic
1016448547 6:144157360-144157382 CCCAGTTCCAGAAATTGCCCTGG - Intronic
1017694356 6:156999730-156999752 CCTAGTGCCTCAAAGTGTGCTGG - Intronic
1018399016 6:163403954-163403976 CCAAGTTCCTTATAATGTCAGGG + Intergenic
1022353512 7:29588421-29588443 CCCAGTGCCTGAAAGAGGCCAGG + Intergenic
1024604909 7:51015102-51015124 CCAAGTTCCTGAATGCACCCGGG - Intergenic
1024798781 7:53051450-53051472 CCATTTTCCTTCAAGTGTCCTGG - Intergenic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1030648661 7:112092952-112092974 CCTAGTAACTGAAAGTGTCATGG + Intronic
1032551875 7:132791866-132791888 CCAAGTTCCTCACTGTGGCCAGG + Intronic
1033053310 7:138026881-138026903 GCAAGTTCCGGAAAGTCTCTGGG - Intronic
1033491113 7:141844916-141844938 TCAAGTTCCTGAGAGTTACCTGG + Intergenic
1040420783 8:47238811-47238833 CCATGATCCTGAACCTGTCCTGG - Intergenic
1046056460 8:109084390-109084412 CCAAGTTCCTGAGAGAGACAGGG - Intergenic
1047306286 8:123655430-123655452 CCACATTCCTGAAAGAGCCCAGG + Intergenic
1047968313 8:130063811-130063833 CCAAGTGCCTGAAAGGGTGCTGG - Intronic
1050567914 9:6905951-6905973 CCATATTTCTGAAAGTATCCAGG + Intronic
1051419207 9:16872878-16872900 CCAAATTCCTGACTGTTTCCTGG + Intergenic
1052628161 9:31003440-31003462 CCATGTTTCTGAAAATGTCAGGG - Intergenic
1058530623 9:105901901-105901923 CTAAGGTCCTGAAAGTGTCAGGG + Intergenic
1060030999 9:120214683-120214705 CCAATTTCCTGAATGGGCCCTGG + Intergenic
1185738479 X:2511671-2511693 CCAAGTCCTTGTCAGTGTCCTGG + Intergenic
1186113886 X:6284591-6284613 CCAACGTCATGAAAGTATCCTGG - Intergenic
1186525726 X:10246497-10246519 TCAAGTTGCAGATAGTGTCCTGG - Intergenic
1187484772 X:19693165-19693187 CCGAGTTCAGCAAAGTGTCCAGG - Intronic
1187612302 X:20955647-20955669 CCAAGGTCCTGCAGGTGCCCTGG + Intergenic
1188424206 X:30027848-30027870 CCAAATTCCAGAAAGTGCCTCGG - Intergenic
1191044013 X:56116480-56116502 GCAAGTTCCTGAAAAGGGCCTGG + Intergenic
1191634278 X:63359511-63359533 CCAAGTGCCATAAAGTGTCTTGG + Intergenic
1193838461 X:86376889-86376911 TCAAATTCCTGAGAATGTCCTGG + Intronic
1196658993 X:118250066-118250088 CCATATTCCTGACAGTGTACTGG + Intergenic
1197722109 X:129752246-129752268 CCAAGTTCGTGACAGCATCCAGG + Exonic
1200242191 X:154502764-154502786 CCAAGTGCCTGAACTGGTCCAGG - Intergenic