ID: 989796344

View in Genome Browser
Species Human (GRCh38)
Location 5:45478825-45478847
Sequence AAGAATAAGCTGAAGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 609
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 549}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989796344 Original CRISPR AAGAATAAGCTGAAGAAGGC AGG Intronic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
902088744 1:13884935-13884957 AAGAAAAAGAAGAAGAAGGAAGG - Intergenic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
903053179 1:20616674-20616696 ATGAAAAAGCTGAAGGAGGCAGG + Intronic
903391317 1:22965355-22965377 CAGAAGAAGCTGCAGATGGCCGG + Intergenic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904849779 1:33448592-33448614 AAAAAGAAGTAGAAGAAGGCAGG + Intergenic
905120793 1:35680242-35680264 AAGAAAAAGGTGAAGTTGGCCGG - Intergenic
906212525 1:44019988-44020010 GAGAGGAAGCTGAGGAAGGCTGG + Intronic
906324838 1:44839023-44839045 AAGAAAAAGTGTAAGAAGGCAGG - Intronic
907131515 1:52101603-52101625 AAGAATAACTAAAAGAAGGCTGG + Intergenic
907229311 1:52980816-52980838 AAGAATAAGCATAAGAAAGATGG - Intronic
907513225 1:54977877-54977899 AAAAAAAAGAAGAAGAAGGCAGG + Intergenic
907812544 1:57885947-57885969 AAGAATAAGATTAAGCAGGAGGG - Intronic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
911546919 1:99228169-99228191 GAGAATGAGATGAAGAAAGCGGG + Intergenic
911678265 1:100683941-100683963 AAGAGGAAGCTGGAGAAAGCTGG + Intergenic
911689262 1:100813318-100813340 AAAAAATAGCTGAAGAATGCAGG + Intergenic
912880239 1:113405069-113405091 ATAAATAAGCTAAAGAAGGCAGG + Intronic
913215576 1:116617273-116617295 AAGAAGAACATGGAGAAGGCAGG - Intronic
913278989 1:117167001-117167023 AAGAATAACCTGAAGCTGGGAGG + Intronic
914262639 1:146011794-146011816 ATGAAAAAGCTGAAAGAGGCAGG - Intergenic
914799774 1:150952222-150952244 CAGAGTAATCTGAAAAAGGCAGG - Intronic
914805908 1:150991529-150991551 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
915662850 1:157418107-157418129 AAGAAGAGGCTGGAGAGGGCTGG - Intergenic
916157536 1:161868795-161868817 AAGAATAAGCTGATGATATCTGG - Intronic
916923980 1:169498341-169498363 AAGAATGAGGAGCAGAAGGCTGG + Intergenic
917292666 1:173487392-173487414 GAGAAGAAGCTGCAGAAGGTGGG + Intronic
917617879 1:176764890-176764912 AAGAATACACTGGAGCAGGCCGG - Intronic
918200067 1:182258343-182258365 AAGAAGAAGGGGAAGAAGGAAGG - Intergenic
918931721 1:190863640-190863662 AAGAATAAGCACAAGAACTCTGG - Intergenic
918942382 1:191017345-191017367 AAAAATTAGTTGAATAAGGCTGG - Intergenic
919908046 1:202091804-202091826 AAGAAAAAGAGGAAGAAGGAAGG - Intergenic
920072600 1:203313266-203313288 AATCAAAAGCTGAAAAAGGCTGG - Intergenic
920077856 1:203350178-203350200 AAGAAGAGGCTGAAGTGGGCAGG - Intronic
920725649 1:208432432-208432454 AAGACAAAGCTCAAGAAGCCTGG - Intergenic
921118780 1:212118817-212118839 AAGAATTACCTGAAGCAGACAGG + Intergenic
922208170 1:223467084-223467106 AAGGATGAGCTGGAGAAGGCTGG - Intergenic
922592839 1:226791519-226791541 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
922997530 1:229976397-229976419 AACAAAGAGCTGAAGAAGGAAGG + Intergenic
923448097 1:234091406-234091428 ACAAATAAGCTGATTAAGGCAGG - Intronic
923933406 1:238729957-238729979 TGGAATATGCTGTAGAAGGCAGG + Intergenic
924060118 1:240165807-240165829 AAGATTAACTAGAAGAAGGCAGG - Intronic
924061374 1:240178427-240178449 AAGAAGAAGAAGAAGAAGGGGGG - Intronic
924324575 1:242882944-242882966 AAGAACAAGATGCAGAAGGTGGG - Intergenic
924383795 1:243485058-243485080 AAGAAGAAGCAGAAGAAGAGAGG + Intronic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
1063034748 10:2275627-2275649 AAGATGAAGCTGGAGTAGGCAGG - Intergenic
1063057221 10:2518961-2518983 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1064317266 10:14269965-14269987 ACGAAAAGGCTGAAGAAGGATGG + Intronic
1064864379 10:19862776-19862798 TACAATAAGTTTAAGAAGGCTGG - Intronic
1065386259 10:25136381-25136403 AAGAATAACCTGAAAAGGGAGGG - Intergenic
1065510336 10:26471977-26471999 ATGAATAAGCTCAAACAGGCCGG - Intronic
1065960335 10:30728956-30728978 AGGAATGAGCAGAAGAAAGCAGG + Intergenic
1066332021 10:34434074-34434096 AATAATGAGCTGAAGGAGGCAGG + Intronic
1067150648 10:43729897-43729919 AAGAAGAAGATGAAGAAGAAGGG + Intergenic
1067150654 10:43730039-43730061 AAGAAGAAGAAGAAGAAGACAGG + Intergenic
1067494000 10:46746079-46746101 AGGAATAAGCACAAGAAGTCTGG - Intergenic
1067600662 10:47594325-47594347 AGGAATAAGCACAAGAAGTCTGG + Intergenic
1068336836 10:55644074-55644096 AAGAATAAGCTGAAAAATTAAGG - Intergenic
1068451928 10:57201701-57201723 AAAAAAAAGCAGAAAAAGGCCGG - Intergenic
1068521043 10:58077791-58077813 AAGAAAAAGAAGAAGAAGACAGG + Intergenic
1068841671 10:61621633-61621655 AAGAATAGTCTGAAGACGTCTGG - Intergenic
1069078290 10:64061800-64061822 AAGAAGTAGCTGAAGAATGGGGG + Intergenic
1069455390 10:68549924-68549946 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1070171332 10:73935110-73935132 GAGAATAAGTTGTAGAGGGCAGG + Intergenic
1070843663 10:79505283-79505305 AAGAGAAAGCTGAAGCAGGGAGG - Intergenic
1070930003 10:80254317-80254339 AAGAGAAAGCTGAAGCAGGGAGG + Intergenic
1071534647 10:86418083-86418105 AAAAATAAGTTGAAAAAGGCAGG - Intergenic
1071652195 10:87402197-87402219 AGGAATAAGCACAAGAAGTCTGG + Intergenic
1072134655 10:92533725-92533747 AAAAAAAAGCTGACCAAGGCTGG + Intronic
1072308779 10:94133943-94133965 AAGAGTATGATGAAGAATGCAGG - Intronic
1073488994 10:103840160-103840182 AACAATAAACTGAACAGGGCAGG + Intronic
1073498058 10:103912067-103912089 AGGCATGAGCTGAAGATGGCAGG + Intronic
1074003109 10:109392155-109392177 ATGAATGAGCTGAAGAAGAATGG + Intergenic
1074576021 10:114670123-114670145 CAGCATAGGCTGAAGAACGCGGG + Intronic
1075622287 10:123936818-123936840 AAGAGGAAGATGAGGAAGGCAGG - Intronic
1076001934 10:126919480-126919502 AAGAATAATGTGAAGAAATCTGG - Intronic
1077738695 11:4820529-4820551 AGGAATAAGAGGAAGAAGGGAGG - Intronic
1078239421 11:9516779-9516801 AAGAACAAGTTGATGAAGGCAGG - Intronic
1078353855 11:10618729-10618751 AAGAATGAGCTGCCGAAGGCAGG + Intronic
1079119494 11:17671886-17671908 AAGAACAAGCTCAAGAACCCCGG + Intergenic
1079169792 11:18081863-18081885 AAGAATAATCTGAAAAATGATGG - Intronic
1079449410 11:20586593-20586615 TAAAATAAGCTTAAGAGGGCCGG + Intergenic
1079656616 11:22993551-22993573 TAAAATTAGCTGAAAAAGGCGGG - Intergenic
1079841468 11:25406002-25406024 AAGAAAAAGATGAAGACTGCAGG - Intergenic
1079975390 11:27084447-27084469 AAAAAAAATCTGAAGAGGGCAGG + Intronic
1080975253 11:37332002-37332024 AGGAATTAGCTGAAGAATGAGGG - Intergenic
1081093369 11:38900565-38900587 AAGAAAAAGCTGGAAAAAGCCGG - Intergenic
1081193702 11:40135705-40135727 AAGAATAATCTGAAAAAGCACGG + Intronic
1081558716 11:44192214-44192236 AAGAAGAAGCAGGAGAGGGCTGG - Intronic
1083298607 11:61728448-61728470 AAGGACAAGCTCAGGAAGGCAGG - Intronic
1084892310 11:72242641-72242663 AAGAAGAAGAAGAAGAAGACTGG - Intronic
1085391943 11:76186691-76186713 CAGAACATTCTGAAGAAGGCGGG + Exonic
1086028202 11:82320402-82320424 TTAAATGAGCTGAAGAAGGCTGG - Intergenic
1086037930 11:82439300-82439322 AAGGAGAAGCCGGAGAAGGCTGG - Intergenic
1086629839 11:89003971-89003993 AAATATAAGCTGAATAAGGTCGG + Intronic
1087162817 11:94966384-94966406 AACAAAAAGCTGAAGAAGAGAGG - Exonic
1087401359 11:97670456-97670478 AAAAACATGCTGAAGAAGCCAGG - Intergenic
1089114026 11:116079474-116079496 ATGAATGAGGTGAAGAAGGGAGG - Intergenic
1089520758 11:119061527-119061549 AAGAACAAGCTGAAGAACAATGG + Intergenic
1089725091 11:120470225-120470247 GAGAATGAGTTGAAGAAGGGTGG + Intronic
1090481736 11:127074949-127074971 CACAACAAGCTGAAGAGGGCAGG - Intergenic
1091756578 12:3056333-3056355 AAGAAAATGCTAGAGAAGGCTGG + Intergenic
1091843735 12:3638602-3638624 ATGAATGAGCTGCAGAATGCTGG - Intronic
1091872810 12:3909188-3909210 AAATATTACCTGAAGAAGGCCGG + Intergenic
1091971221 12:4788537-4788559 AGGAATAGGTTGAAGAAGGGAGG + Intronic
1092952839 12:13524205-13524227 AAGGAGAAGCTGGAGAAGTCAGG + Intergenic
1093075872 12:14758312-14758334 AAGAATAAGATGAAGAAACTGGG - Intergenic
1093515825 12:19985688-19985710 AAGAAAAAGCTAAACAAGACAGG - Intergenic
1093600521 12:21015919-21015941 ATAAATAAGCTGAGGAAGGGAGG + Intronic
1094002919 12:25715691-25715713 AATAAATATCTGAAGAAGGCCGG + Intergenic
1094050027 12:26209005-26209027 AAGAATAAAATGAAGGAGGGTGG - Intronic
1095114147 12:38332005-38332027 AAGAGTAAACAAAAGAAGGCAGG - Intergenic
1095148398 12:38759905-38759927 AGGAACAAGTTCAAGAAGGCTGG - Intronic
1095977046 12:47946910-47946932 AAGAAGAAGCTGATGAAACCAGG + Intergenic
1096149468 12:49299564-49299586 AAGAAGAAGAAGAAGAAGCCCGG + Intergenic
1096336814 12:50763334-50763356 AAGAAAAATCTGAGTAAGGCCGG + Intergenic
1096447460 12:51706471-51706493 AGGAAGAAGGTGAAGAAGGAGGG + Exonic
1096504310 12:52082923-52082945 AAGAATGGGCTGAAGGTGGCAGG - Intergenic
1097710324 12:62910654-62910676 GAGAATTAGCTGACGAAGGAAGG + Intronic
1098305914 12:69102566-69102588 AAAAATAAACTGAATAAGGCTGG + Intergenic
1098591607 12:72220472-72220494 AAAAATAACCTAAAGAATGCAGG - Intronic
1098620411 12:72590641-72590663 AAAAATAAGATTAAGAAGGCTGG - Intronic
1098783436 12:74718348-74718370 AAGAAGAAGAAGAAGAAGACAGG - Intergenic
1099186506 12:79521240-79521262 TAGAATTAGCCGAAGTAGGCTGG - Intergenic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100787337 12:98092309-98092331 AGGAATAAGCCGAGGAATGCGGG + Intergenic
1101418502 12:104529592-104529614 AACAACAAGCTATAGAAGGCTGG - Intronic
1102282307 12:111627977-111627999 AATAATAAGAAGAAGAAGCCAGG - Intergenic
1102699909 12:114830035-114830057 CAGAATAGGATGAAGAAGGGTGG + Intergenic
1102909289 12:116700174-116700196 AAGAATGAGTTGGTGAAGGCAGG + Intergenic
1103070209 12:117935122-117935144 AAGAAGAAGAATAAGAAGGCAGG - Intronic
1103722389 12:122981762-122981784 AGGAAGAAGCTGAAGAAGAAGGG + Exonic
1103767334 12:123290050-123290072 AAGAAGAAGCCCAAAAAGGCGGG - Exonic
1104183594 12:126406426-126406448 TTAAATAAGCTAAAGAAGGCAGG + Intergenic
1104403641 12:128498377-128498399 AAAAAAAACCTTAAGAAGGCTGG + Intronic
1104703431 12:130924677-130924699 AAGAAGAAGAAGAAGAAGACTGG - Intergenic
1105001989 12:132696002-132696024 AAGAACAACATGAGGAAGGCCGG - Exonic
1105219312 13:18310749-18310771 AAGAAGAACATGGAGAAGGCAGG - Intergenic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106184132 13:27393860-27393882 AAGAATAAACTGTAGAAATCTGG - Intergenic
1106722360 13:32448651-32448673 CAGATAAAGCTGAAGAAAGCAGG + Intronic
1106870231 13:34011447-34011469 AAGAATCAGCCGAATATGGCCGG + Intergenic
1107625437 13:42277327-42277349 TAGAATAATCAGATGAAGGCAGG - Intronic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1109573498 13:64223393-64223415 AAGAAAGAGCTTAAGAAGGTTGG - Intergenic
1109630587 13:65040241-65040263 AAGAAAAAGATGAAGAAGAGAGG - Intergenic
1110290235 13:73797357-73797379 AAGAATAAGATGAAGAAAGAAGG - Intronic
1111076792 13:83248023-83248045 AAGAAGAAGCTGAACAAGGAAGG - Intergenic
1111096296 13:83519668-83519690 AAGAATAAATTCAAGAAGTCAGG + Intergenic
1111119736 13:83831045-83831067 AAGAATAATTTAAAAAAGGCAGG + Intergenic
1112766750 13:102753912-102753934 AAGAAAATGCTGAAGCAGGCTGG + Intronic
1113277940 13:108754285-108754307 AAGAACAAGCTGTAGCATGCAGG + Intronic
1113605635 13:111603161-111603183 AACAGAGAGCTGAAGAAGGCCGG + Intronic
1113773976 13:112931914-112931936 AAGAACAAGATGAAGAAGCGTGG + Intronic
1115186908 14:30699004-30699026 AAGAATAACCTACGGAAGGCTGG + Intronic
1115223246 14:31078028-31078050 AAGAAAAGGCTGATAAAGGCCGG - Intronic
1116591510 14:46781586-46781608 AAGAATCAGCTCAAGAATTCTGG + Intergenic
1117302317 14:54441559-54441581 AAGAATAAACGCAAGAAGGAAGG - Intergenic
1117488852 14:56226084-56226106 AAGAAGAAGAAGAAGAAGTCAGG + Intronic
1117745306 14:58863220-58863242 AAGAATAAGTGGAAGATGGATGG - Intergenic
1117783363 14:59257713-59257735 AGGAAGAGGCTGAAGATGGCAGG - Intronic
1118104961 14:62648227-62648249 AAGTAGAAGCTGAGGAAGACTGG + Intergenic
1118837569 14:69487511-69487533 AAGAATAAGCTGGAGAGAACTGG + Intronic
1118841441 14:69516118-69516140 AGTAAAAAGCTGAACAAGGCAGG - Intronic
1119991782 14:79206328-79206350 AAAACTCAGCTGAAGGAGGCTGG + Intronic
1120870408 14:89331650-89331672 AAAAATACGCTGGAGAAGACTGG - Intronic
1121084747 14:91137267-91137289 AAGAAGAATCTGAACAGGGCTGG - Intronic
1122516478 14:102312440-102312462 AATAATAAGCAGTAGAAGACAGG - Intergenic
1122531665 14:102432107-102432129 AAGAAGAAGAAGAAGAAGACAGG + Exonic
1122621645 14:103061128-103061150 AAGAAAAAGAAAAAGAAGGCCGG + Intergenic
1122915488 14:104856426-104856448 AAGCCTAGGCAGAAGAAGGCAGG + Intergenic
1202941964 14_KI270725v1_random:158106-158128 AAGAATAGTTTGAAGAATGCAGG - Intergenic
1123991812 15:25689145-25689167 AGGAAGGAGCTGCAGAAGGCTGG - Intronic
1124969900 15:34477271-34477293 AACAGGAAGCTGAAGAAGGAAGG - Intergenic
1125023559 15:35008485-35008507 GAGAATTACCTGAACAAGGCTGG - Intergenic
1125300537 15:38250542-38250564 AAGAATAAGTTCAAAAAGGCAGG + Intergenic
1125311119 15:38379082-38379104 AAGAAGAAGAAGAAGAAGTCAGG - Intergenic
1125722977 15:41853944-41853966 GAGAAGAGGCTGAAGCAGGCTGG + Intronic
1125778573 15:42242361-42242383 ATGAAGAAGCTGAAGTAGGGTGG + Intronic
1125917679 15:43503749-43503771 AAGAAGAATCAGGAGAAGGCAGG - Intronic
1127193686 15:56561560-56561582 GAGAGTGAGCTGAAGAAGGGCGG + Intergenic
1128095607 15:64952228-64952250 AAGAATAAGAAGAAGAAAGGAGG - Intronic
1128519132 15:68364166-68364188 CAGGATTAGATGAAGAAGGCTGG - Intronic
1129014320 15:72452333-72452355 AACAACAAACTGATGAAGGCTGG - Intergenic
1130045739 15:80443305-80443327 AAGAACAAGTTGATGATGGCAGG + Intronic
1130077850 15:80705081-80705103 AGGCATCAGGTGAAGAAGGCAGG + Intronic
1130528667 15:84728628-84728650 TAGAAAAAGCAGAAGAGGGCCGG - Intergenic
1131060831 15:89403680-89403702 AGGAATGGGATGAAGAAGGCAGG - Intergenic
1131199730 15:90386848-90386870 AAGAATAAACGGAAGAGGGCCGG + Intergenic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1132189421 15:99838478-99838500 AACAGGAAGCTGAAGAAGGAAGG + Intergenic
1133377715 16:5302789-5302811 AAGATTAAACTAAAAAAGGCGGG - Intergenic
1134398214 16:13884944-13884966 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
1135179439 16:20260097-20260119 AAGAATGATGAGAAGAAGGCCGG + Intergenic
1135254532 16:20930488-20930510 AACAAAAAGCTGAGGGAGGCAGG - Intergenic
1135336224 16:21603433-21603455 AAGAATATGCTGTTGGAGGCTGG - Intronic
1135952864 16:26931543-26931565 AAGATTAAGCTGGAGATGGGTGG - Intergenic
1136358859 16:29764637-29764659 AAGAAGCCCCTGAAGAAGGCTGG - Intergenic
1136404926 16:30039416-30039438 AAGAATATGAGGAAGAAGCCGGG - Intronic
1136548178 16:30966932-30966954 AAGACGAAGCTGAAGGAGCCTGG + Exonic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1138933868 16:61695073-61695095 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
1139836826 16:69845751-69845773 AAGAATAATCAGATGAAGCCTGG + Intronic
1140754689 16:78056704-78056726 AAGAATGAGCTGCAGGAGGTGGG - Intronic
1141486927 16:84346625-84346647 AAGAATAAACTGATTGAGGCCGG - Intergenic
1141519289 16:84566876-84566898 AAGAGCGAGCTGAAGAAGGCGGG - Exonic
1142654723 17:1383907-1383929 AAAAATTAGCCGAAGAGGGCTGG + Intronic
1143474938 17:7197044-7197066 GGGAATAAGCTGAGGAAGACAGG + Exonic
1144360242 17:14485223-14485245 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1144810042 17:17993187-17993209 ATGAAGAAGCTGAGGAGGGCTGG + Intronic
1145192661 17:20858538-20858560 AAGAATAAGCTGAAAAATTAAGG - Intronic
1145403180 17:22561608-22561630 AAGAATAAGCTGAAAAATTAAGG - Intergenic
1145987994 17:29060553-29060575 ACCAACAAGCTGAATAAGGCTGG - Intergenic
1146719911 17:35116934-35116956 AGGAATGCTCTGAAGAAGGCAGG - Exonic
1146885742 17:36469642-36469664 AAGAATCAGCTGGAGATGGCCGG - Intergenic
1147561103 17:41509696-41509718 AGGAATAAGCGGAATAAGGGGGG + Intergenic
1148161512 17:45453048-45453070 AAGAAGAAAATGAAGCAGGCTGG + Intronic
1148166309 17:45486284-45486306 AATAATAAACTGAAGCTGGCTGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1150392748 17:64799693-64799715 AAGAAGAAAATGAAGCAGGCTGG + Intergenic
1150397483 17:64832676-64832698 AATAATAAACTGAAGCTGGCTGG + Intergenic
1150700919 17:67446239-67446261 AAGAATCAGTCAAAGAAGGCTGG - Intronic
1150801580 17:68287311-68287333 AAAAAGAAGAAGAAGAAGGCTGG - Intronic
1150883236 17:69055323-69055345 AACAATAATCAGAAGAAAGCTGG + Intronic
1151189770 17:72389669-72389691 TAGAAAAAGCTGGAAAAGGCAGG - Intergenic
1152148039 17:78581011-78581033 AGGCAGAAGCTGAAGAAGGATGG - Intergenic
1152328044 17:79653669-79653691 AAGAATAGGCAGAAGTAGGAAGG + Intergenic
1152775504 17:82199179-82199201 AAGAAAAAGCTATAGCAGGCTGG + Intronic
1153318835 18:3751857-3751879 AAGAAGAAGAAGAAGAAGTCCGG - Intronic
1153351205 18:4082639-4082661 AAAAATCAGCTCAAAAAGGCAGG - Intronic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153771092 18:8416938-8416960 TAGAATAAGTGGACGAAGGCAGG + Intergenic
1155372818 18:25121252-25121274 AGGAAGAAGAAGAAGAAGGCTGG - Intronic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156638234 18:39057279-39057301 AAGAAGAAGAAGAAGAAGCCAGG - Intergenic
1156843997 18:41642158-41642180 AAAAATAAGCATAAGAAAGCTGG + Intergenic
1157045489 18:44098462-44098484 AAGAACAAGCTCAAGAACACTGG - Intergenic
1157253872 18:46120532-46120554 AAGTAAAAGCTGAAAAAGTCAGG - Intronic
1157434850 18:47659724-47659746 AAAAGGAAGCTGAAAAAGGCAGG - Intergenic
1158226914 18:55210921-55210943 TATAAGAAGATGAAGAAGGCCGG + Intergenic
1158701887 18:59755552-59755574 AAAAAAAAGAAGAAGAAGGCTGG + Intergenic
1159120963 18:64170049-64170071 AACAAAAAACTGAAGAAGGACGG - Intergenic
1159395307 18:67847564-67847586 AAGAACCAGCTGAAGAACTCTGG + Intergenic
1160409184 18:78663428-78663450 AAGAAGAGGCTGACCAAGGCTGG - Intergenic
1161564032 19:4989635-4989657 AAGAAGAAGAAGAAGAAGACTGG - Intronic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1161927593 19:7312817-7312839 AAGAATTAGGGAAAGAAGGCTGG - Intergenic
1161957598 19:7505277-7505299 AAGAATAAGGTAAAGTGGGCTGG - Intronic
1162583065 19:11542182-11542204 AAGAAGAAGAAGAAGAAGGTCGG - Intronic
1162645774 19:12049172-12049194 AAGAATAACAAAAAGAAGGCTGG + Intronic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1163703960 19:18801527-18801549 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1164499149 19:28799005-28799027 AAGAATAAGCACAAGAACTCTGG + Intergenic
1164858312 19:31542575-31542597 AAGAAGAAGAAGAAGAAGACAGG - Intergenic
1164944528 19:32282331-32282353 AAGAAAAAGCTGAAAGATGCTGG - Intergenic
1165281600 19:34802877-34802899 AAGGAAAAACTGAAGAAGGGAGG + Intergenic
1165682442 19:37789471-37789493 AAGAAGAAGAAGAAGATGGCCGG + Intronic
1165751074 19:38260435-38260457 AATAAAAAGCTGACCAAGGCCGG + Intronic
1166229732 19:41419428-41419450 AAAAATAAGAAGAAGAAGTCTGG - Intronic
1167120887 19:47515677-47515699 AAAAAATAGCTGAAGAGGGCCGG + Intergenic
1167459361 19:49616117-49616139 AAGAAATGGCTGAAGGAGGCAGG + Exonic
1167944431 19:52976722-52976744 AAAAATAACCTGGAGAAAGCAGG + Intergenic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
925435281 2:3831920-3831942 AAGAGGAAAGTGAAGAAGGCAGG - Intronic
926183020 2:10663068-10663090 AAATAAAAGCTGTAGAAGGCGGG + Intronic
926396599 2:12449191-12449213 AAGAAAAAGATGCAGAGGGCAGG - Intergenic
926697063 2:15778105-15778127 AAGAAAAACCTGAAGAACTCAGG - Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
927478550 2:23432811-23432833 AAGAAGAAGTTGAAGTTGGCTGG + Intronic
928053752 2:28029060-28029082 AAGAAAAAGCCGAAGAGGCCAGG - Intronic
928450079 2:31370843-31370865 ATAAATAAAGTGAAGAAGGCAGG + Intronic
928471894 2:31583045-31583067 ATGCATAAGCTGAAGATGACTGG - Intergenic
928861297 2:35860484-35860506 AAGAAATAGCACAAGAAGGCAGG - Intergenic
929451125 2:42038140-42038162 AACAATAATCTGACCAAGGCTGG - Intergenic
929840778 2:45460490-45460512 AAGGAAATGCTGAGGAAGGCAGG + Intronic
932600081 2:73117879-73117901 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
933606156 2:84386227-84386249 ATGGATAAGCTGTAGAAGGAAGG + Intergenic
933817191 2:86077523-86077545 AAGACTAGGCTGAAGTGGGCAGG + Intronic
934139636 2:89033536-89033558 AACAATAAGCTGACCAAGGATGG - Intergenic
934145667 2:89091269-89091291 AACAATAAGCTGAATAAGGATGG - Intergenic
934184737 2:89661764-89661786 AAGAAGAACATGCAGAAGGCAGG + Intergenic
934223589 2:90109301-90109323 AACAATAAGCTGAATAAGGATGG + Intergenic
934229606 2:90167013-90167035 AACAATAAGCTGACCAAGGATGG + Intergenic
934295020 2:91735897-91735919 AAGAAGAACATGCAGAAGGCAGG + Intergenic
934875943 2:97920182-97920204 AAAAATAAGCTAAAGAAAGCAGG - Intronic
935259894 2:101344814-101344836 AAGAATATCCTGGAGAAGCCAGG + Intergenic
935277316 2:101486143-101486165 ATGATTAAGCTGAAGTGGGCTGG - Intergenic
935305733 2:101734715-101734737 AAGAAGAAGCAACAGAAGGCAGG - Intronic
935458761 2:103302639-103302661 AAGAAGAAGAAGCAGAAGGCTGG - Intergenic
936796595 2:116213994-116214016 TCGAATATGCTGAAAAAGGCAGG + Intergenic
937087415 2:119180671-119180693 AAGAATAAAGTGAACAAAGCAGG + Intergenic
938779059 2:134568226-134568248 AAGAATAAAGGAAAGAAGGCAGG + Intronic
938899059 2:135783139-135783161 AATAAGAAGCTGATGGAGGCAGG - Exonic
939014746 2:136889567-136889589 AAGAAAAAGCTGAACAAGAAAGG - Intronic
939119026 2:138093666-138093688 AAGAAGAAACTGAAGAACGTGGG + Intergenic
939373847 2:141338305-141338327 AAGAGGAAGCAGAAGAAAGCAGG + Intronic
939522764 2:143252138-143252160 CAGAAGAAACTGAAAAAGGCTGG - Intronic
940126377 2:150330532-150330554 AGGAAGAAGAAGAAGAAGGCTGG + Intergenic
940754346 2:157664935-157664957 AAGAATGGGCAGAATAAGGCCGG + Intergenic
940920078 2:159296364-159296386 AAGAACAAGCTGCAGGAAGCTGG - Intergenic
942295893 2:174516883-174516905 AAGAGAAAGGTAAAGAAGGCAGG - Intergenic
942429788 2:175898488-175898510 AAGATTAAGTGGAAAAAGGCCGG - Intergenic
942432298 2:175925404-175925426 GAGGAAAAGCTCAAGAAGGCTGG + Exonic
943519267 2:188927499-188927521 AATAAAAATCTGAAGAAGGTAGG - Intergenic
943991172 2:194694414-194694436 TAGAATAAGATGAATAAGGTAGG + Intergenic
944347292 2:198684600-198684622 GAGGGTGAGCTGAAGAAGGCTGG + Intergenic
944925582 2:204460669-204460691 AAAAATTAGCTGATGAGGGCCGG + Intergenic
946658788 2:221977423-221977445 AAGAATAAACTGGAGACAGCAGG + Intergenic
946886094 2:224224954-224224976 AATAATAAGCTGAAGATAGACGG + Intergenic
947543344 2:230993438-230993460 AAGAAGAAGAAGAAGAAGGTGGG + Intergenic
947898268 2:233695418-233695440 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
947977112 2:234376289-234376311 AAGAATAAAGGGAAGAAGGGAGG - Intergenic
948626292 2:239270520-239270542 CAGAATAAGCTGAAATAGTCCGG + Intronic
1168952177 20:1810071-1810093 CAGAACAAGTTGTAGAAGGCAGG - Intergenic
1169120367 20:3092334-3092356 AAAAATCAGCTGACGAGGGCCGG + Intergenic
1169329917 20:4708279-4708301 ATGCATCAGCTGAAGCAGGCAGG - Intergenic
1169575329 20:6953731-6953753 TAGAATAAGCTGAAAAATGTTGG + Intergenic
1169610196 20:7370622-7370644 AAGAAAAAGCTAATGAATGCTGG + Intergenic
1170096343 20:12649760-12649782 AAAAACAGGCTGCAGAAGGCAGG - Intergenic
1170397590 20:15944288-15944310 AAAAATAAGCAAAAGAAGGAAGG + Intronic
1172422991 20:34833599-34833621 AAGAAGAAGATGAAGAAGATGGG - Intergenic
1172545147 20:35754939-35754961 AAGAAGAAGAAGAAGAAAGCAGG - Intergenic
1172928640 20:38564908-38564930 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
1173163916 20:40672617-40672639 AAGAAAAAGAAGAAGAAGGTGGG + Intergenic
1173936256 20:46867867-46867889 AACAATAAGCATAAGAAGGCAGG - Intergenic
1174942165 20:54941040-54941062 AGGAAGGAGCTGAAGAAGGGAGG + Intergenic
1174978935 20:55369882-55369904 AAGAAGAAGCAGAGGAAAGCGGG + Intergenic
1174984575 20:55436295-55436317 AAGAAGAAGTTTAAGAAGGTGGG - Intergenic
1176581204 21:8528828-8528850 AAGAATAGTTTGAAGAATGCAGG + Intergenic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1178132080 21:29585130-29585152 AAGAATAAGCTAAATAAGGGAGG + Intronic
1178307541 21:31503096-31503118 AGGAAAATGGTGAAGAAGGCTGG + Intronic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1179210319 21:39319258-39319280 AACAATTTGCTGAGGAAGGCAGG - Intronic
1180022833 21:45139746-45139768 ATGAATAAGCTGGAAAAGGCTGG - Intronic
1180816912 22:18795609-18795631 AAGAAGAACATGGAGAAGGCAGG - Intergenic
1181076151 22:20378316-20378338 AAGAATCCCCTGAAGAAGGAAGG + Intronic
1181203101 22:21229954-21229976 AAGAAGAACATGGAGAAGGCAGG - Intergenic
1181294758 22:21827960-21827982 GAAAAGAAGCTGAAGAAGGCAGG + Intronic
1181469662 22:23130157-23130179 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
1182015495 22:27036048-27036070 AAGAAGAAGAAGAAGAATGCAGG - Intergenic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1182677311 22:32049773-32049795 AAGACTTAGATGAAGGAGGCAGG - Intronic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183288501 22:36982916-36982938 AAGAACAAGAGGAAAAAGGCTGG - Intergenic
1183529601 22:38346156-38346178 AAGTTGACGCTGAAGAAGGCCGG - Intronic
1184254288 22:43278333-43278355 AAGGAGTGGCTGAAGAAGGCAGG + Intronic
1185195059 22:49464175-49464197 ATGAATAAACAGTAGAAGGCAGG - Intronic
1203223819 22_KI270731v1_random:65470-65492 AAGAAGAACATGGAGAAGGCAGG + Intergenic
1203267011 22_KI270734v1_random:21330-21352 AAGAAGAACATGGAGAAGGCAGG - Intergenic
949340045 3:3019628-3019650 AAGAATAAGATGGAGAAGCCAGG + Intronic
950435829 3:12979440-12979462 AAAGGTAAGCTGAAGAATGCTGG + Intronic
951037382 3:17948809-17948831 AAGAAAGAGCAGAGGAAGGCAGG - Intronic
952166678 3:30757309-30757331 AAAAATCAGCTGATAAAGGCAGG + Intronic
952708184 3:36401309-36401331 AAGAATATACTGGAAAAGGCAGG - Intronic
952812541 3:37417395-37417417 AATAATAAACAGAGGAAGGCGGG + Exonic
954502554 3:51032486-51032508 CACAATAAGCATAAGAAGGCTGG - Intronic
955933774 3:64082917-64082939 AAGAACAAGCTGTAGAAGCCTGG - Intergenic
956190261 3:66601323-66601345 TAGGAAAAGCTGAAGAGGGCAGG - Intergenic
956191121 3:66609651-66609673 AAGCCTGAGCTGAAGAAAGCTGG - Intergenic
957538528 3:81537797-81537819 AAGAATAAGCATAAGCATGCAGG - Intronic
957799050 3:85050995-85051017 AAGAATAGCATGAAGCAGGCTGG - Intronic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
959317798 3:104831080-104831102 ATGAACAAGATGAAGAAGGAAGG + Intergenic
959468083 3:106714767-106714789 AAGAATAACATGGAGAAGGAAGG - Intergenic
959951159 3:112181936-112181958 AAGACAAAGCTGAAGTAGGCAGG + Intronic
960313664 3:116149254-116149276 AACAATATGGGGAAGAAGGCTGG + Intronic
960545192 3:118906273-118906295 GAGAGGAAGCTGCAGAAGGCAGG + Intronic
960680169 3:120239391-120239413 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
960710478 3:120522610-120522632 AAAAATCAGCTGAAGGTGGCTGG + Intergenic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
963201479 3:142590781-142590803 AAAAATAAGTAAAAGAAGGCTGG - Intergenic
963235580 3:142952790-142952812 AACAAAAAGCAGCAGAAGGCAGG - Intronic
963265858 3:143239353-143239375 AAGAATGAACGGAAGAAGGAAGG + Intergenic
963607544 3:147423973-147423995 AAGAAAAAGCTGGAGAAGGATGG + Intronic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
963932200 3:151015020-151015042 AGAAATACGCAGAAGAAGGCTGG - Intergenic
964201108 3:154120636-154120658 AAGACTAGGCTGAAGAAGTAGGG + Intergenic
965496173 3:169401654-169401676 AAGAATAAGCTGAAGAAGAAAGG + Intronic
966047014 3:175564560-175564582 AAGATAAACCTCAAGAAGGCTGG + Intronic
966432067 3:179842649-179842671 ACGAATATACTAAAGAAGGCAGG + Intronic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
966781615 3:183589099-183589121 AAGAATAAGCTCTAGATGCCTGG - Intergenic
966830858 3:184007314-184007336 AAAAATAAGCAGAAGTGGGCCGG - Intronic
967472917 3:189883869-189883891 AACCATAAGCTAAAGAAAGCAGG + Intronic
968210619 3:196845648-196845670 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
968399055 4:272496-272518 AAGAAAAAGCTGTAAAAGGAAGG - Exonic
968524266 4:1048028-1048050 ATGATTTAGGTGAAGAAGGCTGG + Intergenic
969255075 4:5995959-5995981 AAGAAGAACCTGAAGGAGGTAGG - Intergenic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970964505 4:21912951-21912973 GAGAGTAAACTGAAGAAGACAGG + Intronic
970994580 4:22250642-22250664 AAGAATAACCAGAAGCAGGTTGG - Intergenic
971118828 4:23680968-23680990 AAGTATAGACTGAAGAAAGCTGG - Intergenic
971386481 4:26145011-26145033 AAAAAGAAGAAGAAGAAGGCAGG - Intergenic
971400923 4:26274637-26274659 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
971420268 4:26467987-26468009 AAGAAGAAGAAGAAGAAAGCGGG + Intergenic
972419780 4:38876465-38876487 GAGAATAAGCATAGGAAGGCAGG - Intronic
973007316 4:45029229-45029251 AAGAATAAGCTGAAGGCAACGGG + Intergenic
974226922 4:59058549-59058571 AAGAATAAGATGTAGAGGGATGG - Intergenic
974621047 4:64355500-64355522 AAGAATAAGTTAAAACAGGCCGG + Intronic
975197549 4:71543153-71543175 AAGAATTAGCTAAATGAGGCTGG + Intronic
975449274 4:74505471-74505493 AAGAGTGAGCTGAAGCAGGGTGG + Intergenic
975796285 4:78010091-78010113 AAAAACAATCTGAAGAATGCAGG - Intergenic
976891950 4:90059589-90059611 AAAAATAACCTGAATAAAGCTGG - Intergenic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
978600569 4:110423295-110423317 AAAAATAAAAAGAAGAAGGCTGG + Intronic
978684255 4:111420041-111420063 AAAAATTGGATGAAGAAGGCTGG - Intergenic
978868019 4:113538841-113538863 AACAATAGCCTGAAGAAGTCTGG - Intronic
979280821 4:118865718-118865740 AAGAATAACCTGAAAAAGCACGG + Intronic
979971606 4:127142643-127142665 TAGAATAAGTTGGAGAGGGCTGG - Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
981315169 4:143334786-143334808 AAGAAAAATCTGAAAAAGCCTGG - Intergenic
982183935 4:152777611-152777633 AAGAAAAAGAGGAAGAAGGAAGG + Intronic
982338698 4:154270512-154270534 AAGAAGAAGGTGGAGATGGCAGG + Intronic
982544092 4:156711108-156711130 ATGAATAAGCAGAAGACTGCAGG - Intergenic
982931137 4:161408479-161408501 AAGAATAAGCTCAAGAATGCTGG + Intronic
983231543 4:165134053-165134075 AAGAATAAACTGAAATAGTCTGG - Intronic
983581229 4:169311903-169311925 AGGAAGAAACTGAAGAAGCCAGG - Intergenic
984692368 4:182741714-182741736 AAAAATAAGCTAAATAAGGCTGG - Intronic
985099215 4:186441698-186441720 CAGCATCAGCTGAAGAAGCCTGG + Intronic
985148820 4:186923863-186923885 AAGAGGAAGATGAAGAAGGGTGG + Intergenic
985341519 4:188959662-188959684 AGGAATCAGCTGAAGAATGCAGG - Intergenic
985556319 5:559955-559977 AAAAAGAAGCTGGACAAGGCTGG - Intergenic
985988927 5:3539154-3539176 AAGGACAAGGGGAAGAAGGCTGG - Intergenic
986037606 5:3955058-3955080 AAGAATAGGAAGAAGAAGGAAGG - Intergenic
986731944 5:10641205-10641227 AAGAAGAAGAAGAAGAAGACTGG - Intronic
986949373 5:13063161-13063183 ATGAGTAAAGTGAAGAAGGCAGG + Intergenic
987304317 5:16623447-16623469 CAGAGAAAGCTGAAGAAAGCAGG - Intergenic
988318165 5:29658842-29658864 AAAAATAATCTGAGGAAGGCTGG + Intergenic
988712752 5:33794491-33794513 GAGAATAAGCTGCAGCAGGCTGG - Intronic
989090591 5:37726217-37726239 AAGAAGAAACTAAATAAGGCAGG - Intronic
989403456 5:41034084-41034106 ATGAGTAAGCTGCAGAAGGCAGG + Intronic
989522504 5:42418395-42418417 GAGAATAAGCTGAAGCAGGGTGG - Intergenic
989540318 5:42610606-42610628 GAGAAGGAGCTGCAGAAGGCTGG + Intronic
989784055 5:45305744-45305766 AAGAAGAAACAGAAGAAGGGAGG + Intronic
989796344 5:45478825-45478847 AAGAATAAGCTGAAGAAGGCAGG + Intronic
990056206 5:51582220-51582242 AAGTATAAGCTGAGAAAAGCAGG + Intergenic
990408358 5:55514820-55514842 AAAGATAAGATGAAGAAGGAAGG + Intronic
991108772 5:62873207-62873229 AAGTATAAACTGAACATGGCAGG - Intergenic
991112523 5:62917057-62917079 AAGGATAAACTAAAGAAGGTAGG + Intergenic
991976489 5:72188331-72188353 GAGAGAAAGCTGCAGAAGGCTGG + Intronic
992023000 5:72643360-72643382 AAGAAGAAGCCAAAGAAGGGAGG - Intergenic
992553239 5:77879410-77879432 AGTAAAAAGATGAAGAAGGCAGG - Intergenic
992654539 5:78895525-78895547 AGGTATCAGGTGAAGAAGGCAGG - Intronic
992742660 5:79789830-79789852 AAGAATAAACAGAACAAGGCTGG - Intronic
993946131 5:94118657-94118679 AGGACTAAACTGAAGAAGACTGG - Intergenic
994006787 5:94846665-94846687 AAGAATAACCTGAAGAGAGTTGG + Intronic
994055824 5:95413886-95413908 AAGAATGAGCTGGAGGAGCCAGG - Intronic
994350230 5:98737357-98737379 GAGCATAAGCTGAAGCAGGGTGG + Intergenic
994627107 5:102233553-102233575 AAAAAAAAGCTGAAGGAGCCTGG + Intergenic
994820503 5:104644782-104644804 AAGTATAAGATGAAGAAAGAGGG - Intergenic
997963404 5:138338806-138338828 AAGAAAAACATGAGGAAGGCAGG - Intronic
997992532 5:138557411-138557433 AGAAATATGCTGAAGAAGACCGG - Exonic
998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG + Intergenic
999416655 5:151403512-151403534 AAGACAAAGCTGGAGCAGGCAGG - Intergenic
999809962 5:155118252-155118274 AAGAAAAAGCAGAGGAAGGAGGG + Intergenic
1000190996 5:158910413-158910435 ATGGATATGCTGAAGAAGGTGGG + Intronic
1000420459 5:161032797-161032819 AAGAATATTCTCATGAAGGCTGG - Intergenic
1000600325 5:163266134-163266156 AAAAAGAAGCTGAAGAGGCCGGG + Intergenic
1001016773 5:168149073-168149095 AAGAATTAGATGAAGCTGGCCGG + Intronic
1001884533 5:175277525-175277547 AAGGATTGGCAGAAGAAGGCAGG - Intergenic
1001945856 5:175777436-175777458 AAGAGTGAGGTGAAGAAGGGAGG - Intergenic
1002720494 5:181258093-181258115 AAAAGTTAGCTGAGGAAGGCTGG + Intronic
1003481644 6:6539446-6539468 AATAATAGACTGTAGAAGGCAGG - Intergenic
1003553509 6:7120105-7120127 AAGAAATAGCTAAAAAAGGCGGG - Intronic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1006677579 6:35775579-35775601 AAAAAAAAGCAGAAGCAGGCAGG + Intergenic
1006751316 6:36379579-36379601 AAGAAGAAAAAGAAGAAGGCCGG + Intronic
1006967299 6:38001050-38001072 GAGAATAGGTTGAAGAATGCAGG + Intronic
1007169914 6:39855767-39855789 AGGAAAGAGTTGAAGAAGGCTGG - Intronic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1008652280 6:53575682-53575704 AAAAATAAGCTTAAAAAGGTAGG + Intronic
1010431699 6:75784824-75784846 AAGTATCAGCTGAAGATTGCGGG + Intronic
1010917793 6:81641999-81642021 AAGAATGAACTGAAGAAGGAAGG + Intronic
1011298319 6:85847428-85847450 GAGAGTGAGCTGAAGAAGGGTGG - Intergenic
1011553173 6:88548311-88548333 AAGAGTGAGGGGAAGAAGGCAGG + Intergenic
1011774311 6:90711330-90711352 ATGAATAAGCTGCAGAAGCGTGG + Intergenic
1012054953 6:94394507-94394529 GAGAAGAAGCAGAAGAAGTCAGG + Intergenic
1012258378 6:97060381-97060403 GAGGATGAGCTGAAGAAGGAGGG + Intronic
1012421438 6:99070120-99070142 AAGTGAAACCTGAAGAAGGCTGG - Intergenic
1012430804 6:99161816-99161838 AATAATGTGCTGAAGAAAGCAGG + Intergenic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1013164283 6:107575731-107575753 AATAATAAGAAGAAGAAGACAGG + Intronic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1015458979 6:133466675-133466697 AAGAGTTAGGTGAAGAAGGAGGG + Intronic
1016299464 6:142614227-142614249 ATAAAGAAGCTGCAGAAGGCAGG - Intergenic
1016794118 6:148099645-148099667 AAGAAGAAGAAGAAGAAGCCTGG - Intergenic
1016801476 6:148173513-148173535 AAGAAGAAGGGGAAGAAGGGGGG + Intergenic
1017238515 6:152141772-152141794 AAAAATAAGCAGAGGTAGGCTGG + Intronic
1017248531 6:152254544-152254566 AAGAATATGCAGAAAATGGCCGG - Intronic
1017429006 6:154352009-154352031 AAGAATAAGCTAATGGATGCTGG + Intronic
1017611459 6:156190789-156190811 CAGCACAAGGTGAAGAAGGCCGG - Intergenic
1017873727 6:158506524-158506546 AAGAATAAGGTGAAAAGGCCAGG - Intronic
1017988542 6:159466182-159466204 AAGAAGAAGAAGAAGAAGCCGGG - Intergenic
1018733154 6:166668508-166668530 AAGAATTGGCTGAGTAAGGCTGG + Intronic
1019465964 7:1189138-1189160 AGGAAGAAGAAGAAGAAGGCGGG + Intergenic
1020121669 7:5507537-5507559 AATAATTAGCAGAACAAGGCCGG + Intronic
1020362501 7:7343633-7343655 AAGAATAAGCATAACAAAGCTGG - Intergenic
1020413759 7:7922446-7922468 AACAATCTGCTGAAGAAAGCAGG - Intronic
1021015585 7:15527158-15527180 ATGATTAAGCTTAAGAAGGAAGG + Intronic
1021402088 7:20220874-20220896 AAGAAAAATCTGAACAAGGGGGG - Intergenic
1021424582 7:20485830-20485852 AATACTAAACTGAAGAATGCTGG + Intergenic
1021610584 7:22454154-22454176 AAGAGAAAGCTAAAGAATGCAGG + Intronic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1023215604 7:37859307-37859329 AAGAATAAGCATTAGAAGGATGG - Intronic
1023265878 7:38404697-38404719 AAGAATCAGCAGAAGAACTCTGG + Intronic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1024271277 7:47644061-47644083 AAAAATAAGCTAAAGAAATCAGG - Intergenic
1024581864 7:50807090-50807112 AAGAATAACATTAAAAAGGCTGG - Intergenic
1024827976 7:53414974-53414996 AAGAAAAAGATGAATCAGGCCGG - Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1026425537 7:70288652-70288674 AAGAAGAAACTGATCAAGGCAGG + Intronic
1026441060 7:70444715-70444737 AAGAATAACCCAAAGAAAGCTGG + Intronic
1026645195 7:72161379-72161401 AAGAATAAGGTGGAGAAGGATGG + Intronic
1027251825 7:76403629-76403651 AAGAATAAGTTGAATCAGCCAGG - Intronic
1027557038 7:79677751-79677773 AAGAATAAGTGGAAAAAGGAGGG + Intergenic
1029539752 7:101175629-101175651 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
1031099097 7:117456605-117456627 AAGATTAAGAGGAAGAAAGCAGG - Intergenic
1033205181 7:139414134-139414156 TAGAATGAGGTGAAGAAGGGGGG - Intronic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033592681 7:142825924-142825946 AAAATTAAGCTGAAGAAAGAAGG + Intergenic
1034118376 7:148604735-148604757 TAAAATAAACAGAAGAAGGCAGG + Intronic
1035232997 7:157477530-157477552 AAGAAGAAGATGGAGAAGCCAGG + Intergenic
1037249715 8:16878054-16878076 AAAAATAAATTGATGAAGGCAGG + Intergenic
1039334081 8:36570803-36570825 AAGAATTTGCTAAAGACGGCAGG - Intergenic
1039754911 8:40512728-40512750 GAGAACAAGCTGAAGCAGGGTGG - Intergenic
1040501351 8:48008216-48008238 AAGAATAAGTTCATGAGGGCCGG - Intergenic
1040816975 8:51519243-51519265 AAGAATTTCCTGAAGAAGGCCGG + Intronic
1042948901 8:74180922-74180944 AGGAAAAGGCTGAAGAAAGCAGG + Intergenic
1045578668 8:103453962-103453984 AAGAATAAGGTGAAGGATGGTGG + Intergenic
1046106921 8:109677587-109677609 ATTAATAAGCTGAGGAAGGAAGG + Intronic
1046283556 8:112066287-112066309 AAGAAATAGCTGAAAGAGGCAGG - Intergenic
1046401304 8:113707640-113707662 AAAAGTAAGGTGAAGAAGGAAGG - Intergenic
1046874837 8:119242601-119242623 AAAAATCAGCAGAAGAAGGGTGG + Intronic
1048073828 8:131047072-131047094 AAGGAAAAACAGAAGAAGGCAGG - Intergenic
1048224388 8:132570702-132570724 AAGGATCAGCTGCAGCAGGCTGG - Intergenic
1048430863 8:134369282-134369304 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1049287531 8:141783906-141783928 AACAATAAGCTCCAGAAAGCCGG + Intergenic
1049989720 9:979169-979191 AAGAATACTCTGAAGAACACAGG - Intronic
1050193511 9:3055487-3055509 TAGAATAAGATAAAGAAGGGAGG + Intergenic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1051878355 9:21813835-21813857 AAGGATAAGATGGAGAAGCCAGG + Intronic
1052185990 9:25594957-25594979 AAGAATAACATAAAGAGGGCAGG - Intergenic
1052191199 9:25664637-25664659 AACAAATAGTTGAAGAAGGCTGG - Intergenic
1052951017 9:34211697-34211719 AAGGAAAAGTTGAAGGAGGCAGG - Intronic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1054986068 9:71262812-71262834 GAGAGTGAGCTGAAGCAGGCTGG - Intronic
1055405044 9:75965526-75965548 AACAAAAAGCAGAAGAAGGGAGG - Intronic
1055923205 9:81483507-81483529 AATTATAAGCTGAAAAAGCCAGG - Intergenic
1056265464 9:84892575-84892597 CAGAATAAGCTGAAGAAAACAGG + Intronic
1056461880 9:86816645-86816667 TAAAATGATCTGAAGAAGGCAGG + Intergenic
1056477236 9:86964498-86964520 AAAACTAAGCAGAACAAGGCAGG - Intergenic
1057764244 9:97902166-97902188 AAGAATAAGCTGCACAGGTCAGG + Intergenic
1058767344 9:108194647-108194669 GAGAATGAGCTGGAGGAGGCAGG - Intergenic
1059191102 9:112327267-112327289 AAAAATTACATGAAGAAGGCCGG + Intronic
1059482134 9:114599819-114599841 TAAATTAAGCTGAAGGAGGCCGG - Intergenic
1059728200 9:117029569-117029591 ACCACTAAGCTGGAGAAGGCCGG + Intronic
1059799485 9:117735881-117735903 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1059936191 9:119313365-119313387 AAGAATGAGAGGAAAAAGGCCGG - Exonic
1059961925 9:119574009-119574031 AAGACTGAGATGAAGGAGGCAGG - Intergenic
1060193163 9:121605799-121605821 AAGAAAATGCTAAAGAAGCCAGG - Intronic
1060673451 9:125490984-125491006 AAAAATTAGCTGAGGATGGCGGG + Intronic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1060871001 9:127040102-127040124 AAGAAAAGGCTGAAGTAGGCCGG + Intronic
1061531357 9:131216184-131216206 TAAAATTAGCTAAAGAAGGCTGG - Intronic
1061639548 9:131941505-131941527 AACTTTAAGCTGAAGAAGGAAGG + Intronic
1203611223 Un_KI270749v1:6873-6895 AAGAATAGTTTGAAGAATGCAGG + Intergenic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1186283487 X:8019261-8019283 ATCATTAAGCTGCAGAAGGCTGG - Intergenic
1186299586 X:8185295-8185317 AAGAGAAAGCTGAAGAAGATAGG + Intergenic
1186519154 X:10189959-10189981 AAGAAGAAGGTGAAGAAGATGGG - Intronic
1186827010 X:13350456-13350478 TAGAATAAGCTGAGGAGGGTGGG + Intergenic
1188018552 X:25131514-25131536 ACAAATAATCAGAAGAAGGCTGG + Intergenic
1188149743 X:26657150-26657172 AAGAACAAGCTCAAGAATTCTGG - Intergenic
1189533994 X:41917458-41917480 AAGAATAATCTCAAGAAGCAAGG + Intronic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1190062835 X:47222032-47222054 AAGAGGAAGCAGAAGACGGCTGG + Intronic
1190415210 X:50174119-50174141 AAAAAGAAGCTGAATGAGGCTGG + Intergenic
1192130219 X:68542879-68542901 AAAAAGAAGAAGAAGAAGGCTGG - Intergenic
1192453174 X:71255937-71255959 AAGTATATGTTGAGGAAGGCAGG - Intergenic
1192539919 X:71959093-71959115 AAGAATAAGTTGATCAAGGGTGG + Intergenic
1192960435 X:76124792-76124814 AAGACTAAGATGAATAAGGAGGG - Intergenic
1193236377 X:79112751-79112773 AACATGAAGCTGAGGAAGGCAGG - Intergenic
1194415380 X:93605793-93605815 AAGAATAAGCTAAGCAATGCTGG + Intergenic
1194767621 X:97860448-97860470 AGGAAGAAGCTGAGGGAGGCTGG + Intergenic
1195120316 X:101743698-101743720 AAAAATAATTTAAAGAAGGCAGG - Intergenic
1195575411 X:106444150-106444172 AAGGATAGACTGAAGAAAGCTGG + Intergenic
1195914281 X:109920707-109920729 CAGAATAAACTGGAGAAGGGGGG - Intergenic
1196150750 X:112370653-112370675 AACAATAAGCTGAAGATGCATGG - Intergenic
1196256396 X:113524244-113524266 AAGAATAAGCAGAATATGGTTGG - Intergenic
1197300290 X:124771528-124771550 ATACGTAAGCTGAAGAAGGCAGG + Intronic
1197634904 X:128903976-128903998 ATGAACAAGCTGAACTAGGCTGG - Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1199573321 X:149289668-149289690 AAGAGTGAGATGAAGCAGGCTGG - Intergenic
1199702918 X:150398387-150398409 AAGAAGAAGAAGAAGAAGACAGG + Intronic
1200052392 X:153441582-153441604 CAGATTAAACTGAAGAATGCTGG + Intergenic
1200243837 X:154512276-154512298 AAGAAGAAGAAGAAGAAGCCGGG + Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200927578 Y:8668454-8668476 AAGAACAAGCTGACTAATGCTGG - Intergenic
1201222113 Y:11781937-11781959 AAGAACAAGATGCAGAAGGTGGG - Intergenic
1201298448 Y:12485767-12485789 AAGAATAAGGTGAGGAAGGAGGG - Intergenic
1201408044 Y:13668634-13668656 GAGAAAAAGCTGAAGAAGCAGGG + Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic