ID: 989796896

View in Genome Browser
Species Human (GRCh38)
Location 5:45485270-45485292
Sequence CATTTTAGTTCTTCCTACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989796893_989796896 4 Left 989796893 5:45485243-45485265 CCTTGTAAATATCTTCCACACAT 0: 1
1: 0
2: 3
3: 27
4: 322
Right 989796896 5:45485270-45485292 CATTTTAGTTCTTCCTACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989796896 Original CRISPR CATTTTAGTTCTTCCTACTA AGG Intronic
No off target data available for this crispr