ID: 989799181

View in Genome Browser
Species Human (GRCh38)
Location 5:45514702-45514724
Sequence ATTGAAAAGGTTTCCTCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 427}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989799181_989799184 4 Left 989799181 5:45514702-45514724 CCTACAGAGGAAACCTTTTCAAT 0: 1
1: 0
2: 0
3: 24
4: 427
Right 989799184 5:45514729-45514751 CCATGAACAGAATACACATTTGG No data
989799181_989799186 18 Left 989799181 5:45514702-45514724 CCTACAGAGGAAACCTTTTCAAT 0: 1
1: 0
2: 0
3: 24
4: 427
Right 989799186 5:45514743-45514765 CACATTTGGCAAATGTTCATGGG 0: 1
1: 0
2: 0
3: 21
4: 293
989799181_989799185 17 Left 989799181 5:45514702-45514724 CCTACAGAGGAAACCTTTTCAAT 0: 1
1: 0
2: 0
3: 24
4: 427
Right 989799185 5:45514742-45514764 ACACATTTGGCAAATGTTCATGG 0: 1
1: 0
2: 1
3: 27
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989799181 Original CRISPR ATTGAAAAGGTTTCCTCTGT AGG (reversed) Intronic
907389844 1:54151115-54151137 AATGAGAAGGTTTCTTCAGTTGG + Intronic
909700420 1:78515136-78515158 ATTGATAAAGTTTTCTCTTTTGG + Intronic
910382496 1:86643919-86643941 ATTGAAAAGGGATCCTTGGTTGG + Intergenic
910451923 1:87355930-87355952 ATTAAGAAGATTTCCTTTGTTGG + Intergenic
911934150 1:103945689-103945711 ATTGAAAAGAGCTCCTTTGTTGG + Intergenic
915693106 1:157710322-157710344 ATTGCAAACGTTTTCTCTTTAGG + Intergenic
916168447 1:161983345-161983367 ATTGAAAAGGTTTCTTCATCTGG - Exonic
917688198 1:177439901-177439923 ATTGCAGAGGTTTCATCTGCTGG - Intergenic
918869704 1:189953319-189953341 ATTTAAAATGTTTATTCTGTTGG + Intergenic
919368360 1:196694618-196694640 ATAGGAAAGTTTTACTCTGTTGG - Intronic
919652161 1:200160997-200161019 AGTGAAGAGGTTTTCTCTGAGGG + Intronic
920143177 1:203835006-203835028 ATAGATAAGGTTTCCTTTTTAGG - Intronic
920190838 1:204192791-204192813 TTAGAAAAGGTGGCCTCTGTGGG - Exonic
921130280 1:212213917-212213939 ATTGCAAGGCTTTCCTCTGTGGG + Intergenic
921300282 1:213745338-213745360 CTTGAAATGGTTTCCTCTGGGGG + Intergenic
921696623 1:218218107-218218129 ATAGAAAAAGTATCCTCTGCCGG + Intergenic
923193687 1:231643971-231643993 TTTTAAAAGGTATCTTCTGTGGG - Intronic
1062825133 10:561673-561695 ATTGAAGAGGTTTCCTTCCTGGG - Intronic
1063051735 10:2457022-2457044 TTTGAAAGGGCTTCCTCTGCAGG - Intergenic
1064795444 10:19006874-19006896 ATTGACAAGGTTGCCTCTGATGG - Intergenic
1064827094 10:19416823-19416845 TTTGAAAAGTTTTCCTGTGCAGG - Intronic
1065439615 10:25737757-25737779 ATAGAAAATGATTCCTCTGATGG + Intergenic
1066179636 10:32947512-32947534 ATTTAAAAGGTTTCCTGTTTGGG + Intronic
1066810122 10:39320288-39320310 AAGGAAAAGTTTACCTCTGTGGG + Intergenic
1067064978 10:43099038-43099060 TTTTAAAAGCTTTCCACTGTGGG + Intronic
1067235872 10:44448855-44448877 ATAGGAAAGTTTTACTCTGTTGG - Intergenic
1067840454 10:49672587-49672609 AATGGAATGTTTTCCTCTGTGGG - Intergenic
1067897336 10:50198125-50198147 AATGAAATGGTTGTCTCTGTAGG - Intronic
1067951635 10:50743895-50743917 AATGAAATGGTTGTCTCTGTAGG + Intronic
1070122288 10:73589825-73589847 ATAAAGAAGATTTCCTCTGTAGG + Intronic
1071317505 10:84416569-84416591 ATTAAAACTGTTTCCTATGTTGG - Intronic
1073528179 10:104205827-104205849 ATTAAAATGGTTTCCTCTTTGGG - Intronic
1077978217 11:7272272-7272294 ATTAAAAAGGCTTCCACTGAGGG - Intronic
1079061435 11:17252196-17252218 ATTCAAAATTATTCCTCTGTAGG - Intronic
1079794017 11:24776269-24776291 TTTGAAAAGGTTTTCTCCATAGG - Intronic
1080292276 11:30684365-30684387 ATTGAAGAGCTTGCCTCTGAAGG + Intergenic
1080297124 11:30743202-30743224 ATTTAAAAGGATTCCTAGGTGGG - Intergenic
1080406348 11:31983122-31983144 ATTGATTAGGTTTGATCTGTGGG + Intronic
1080633136 11:34098508-34098530 ATCAAACAGGTTTCCTCTATTGG + Intronic
1081724550 11:45318924-45318946 ATCGAAATAGATTCCTCTGTAGG - Intergenic
1081826443 11:46058274-46058296 ATCTATAATGTTTCCTCTGTTGG - Intronic
1086356097 11:86001442-86001464 ATTGCACTGGTTTCCTCTCTTGG - Intronic
1086521045 11:87667952-87667974 TGTGAAAAGGTTTTCTGTGTTGG - Intergenic
1088761850 11:112938027-112938049 ATTGAAAATCTTTGATCTGTGGG + Intergenic
1088989578 11:114940410-114940432 TTTTAAGAGGTTTCCTCTGGGGG - Intergenic
1090651981 11:128815072-128815094 CTTGAAAAGGTGTCCTTTGGGGG + Intergenic
1091491952 12:940296-940318 AATGAAAGGGTACCCTCTGTTGG + Intronic
1091516624 12:1189837-1189859 ATTGAAATGCTTTTCTTTGTAGG + Exonic
1091517181 12:1196475-1196497 GTTGGAAAGGTTTCTTATGTAGG + Intronic
1093996458 12:25648140-25648162 ACTGAAAATGTTACTTCTGTAGG + Intronic
1094181402 12:27595944-27595966 ATTGAAGAGGATTCCTCTTGAGG + Intronic
1097763592 12:63497388-63497410 ATTGAAAAACTGTCATCTGTTGG + Intergenic
1100087596 12:90930549-90930571 ATAGAAAACGTTTACACTGTTGG + Intronic
1100244362 12:92742391-92742413 ACTTACAAGGTTTCCTTTGTTGG - Intronic
1101744973 12:107532581-107532603 ATTAAATAGGTTTCCTATGCAGG - Intronic
1102533022 12:113560770-113560792 CTAGAAAAGTTTTCCCCTGTAGG + Intergenic
1104242732 12:127006312-127006334 ATTGAAAAGCTTTTCTAAGTTGG - Intergenic
1105636001 13:22215965-22215987 ATGCAAAAGGCTTCCTCAGTAGG - Intergenic
1105637787 13:22232106-22232128 ATTGAAGAGGGACCCTCTGTTGG + Intergenic
1105733094 13:23239101-23239123 ATTGAACATGTTTTATCTGTAGG - Intronic
1109878025 13:68430845-68430867 TTTGCAAAGGTATCTTCTGTGGG - Intergenic
1109930139 13:69205647-69205669 ATTGCAAAAATTTTCTCTGTAGG - Intergenic
1110281641 13:73700373-73700395 AATGAAAACCTTTCCTATGTGGG + Intronic
1110345594 13:74444089-74444111 ATTTCATAGGTTTCCTATGTAGG + Intergenic
1110952220 13:81510069-81510091 ATTGAAATGGCTTTCTCTGTGGG - Intergenic
1111057389 13:82969039-82969061 ATTGAAAATGTTTATACTGTAGG + Intergenic
1112548702 13:100398334-100398356 ATTGAGAACGTTACCTCAGTGGG + Intronic
1113179680 13:107611222-107611244 CTTGAAACGGAGTCCTCTGTCGG + Intronic
1114761961 14:25325845-25325867 ATTGAAAACTTTTCCTCTTTTGG - Intergenic
1116845803 14:49863731-49863753 GTTGAAAAGTTTTTGTCTGTTGG - Intergenic
1117016415 14:51522709-51522731 ATTGAAAATTCTTCCTATGTTGG + Intronic
1117279968 14:54230067-54230089 ATTTAAAAGGTACCCTGTGTAGG + Intergenic
1117512497 14:56467382-56467404 ATGGAAAATGTTTCATGTGTTGG - Intergenic
1117998885 14:61504605-61504627 ATTGAGAGGGGTCCCTCTGTAGG + Intronic
1118037742 14:61886375-61886397 TTTGAAAAGAGTTCCACTGTGGG - Intergenic
1118073687 14:62274566-62274588 ATTAAAAAGTTCTCCTCTTTAGG + Intergenic
1118720187 14:68588452-68588474 AATGAAAAGCTTACCACTGTTGG - Intronic
1120345681 14:83286844-83286866 TTAGAAATGGTTTCCTCTTTTGG - Intergenic
1124340530 15:28886777-28886799 ATTGATAAGTTTTCCCCTCTGGG - Intronic
1124602984 15:31150164-31150186 ATGGAAAGGGTTTCTTCTATAGG + Intronic
1124983183 15:34582975-34582997 ATTGAGAAGTTTTTCTCTCTGGG + Intronic
1125478725 15:40065276-40065298 TTTCAAAAGGTTTTCTCTCTGGG - Intergenic
1126141749 15:45444950-45444972 CTTGAAAAGGTTTACTGGGTGGG + Intronic
1126517807 15:49555427-49555449 ATTGGTGAGGTTTCCTTTGTAGG + Intronic
1131189983 15:90306855-90306877 ATGGAAACAGTTTCCTCTCTTGG + Intronic
1132235556 15:100217742-100217764 AGTGAAAAGGTTCCCACAGTGGG + Intronic
1134128998 16:11635767-11635789 GATTAAAAGCTTTCCTCTGTGGG + Intronic
1137444658 16:48524324-48524346 TTTGACAAGGTTTCTTCTCTAGG + Intergenic
1137462231 16:48675531-48675553 ATAGACAATGATTCCTCTGTTGG + Intergenic
1137792763 16:51188774-51188796 AATGAAAATGATTCCCCTGTTGG - Intergenic
1140674885 16:77318292-77318314 TGTGAAATGGTTGCCTCTGTGGG - Intronic
1141576726 16:84968764-84968786 ATTGTAAATGTTTACTCTGGTGG + Intergenic
1143412927 17:6722964-6722986 ATTTAAAAGGTTGTCTCTGGGGG - Intergenic
1144129802 17:12235268-12235290 ATGGAAAAGATTTACGCTGTGGG - Intergenic
1147199434 17:38790264-38790286 AGTGGAATGGTTTCCTCTGTAGG - Intronic
1149140419 17:53426634-53426656 ATTCAAAAGCTTTCCCATGTGGG - Intergenic
1150056264 17:62020123-62020145 ATCTAAAAGGATTACTCTGTTGG - Intronic
1150187431 17:63198961-63198983 ATTGAAAAGATTTACTTGGTTGG + Intronic
1154071440 18:11155787-11155809 ACTGAAAAGCTTTTCTCCGTAGG + Intergenic
1154100340 18:11466982-11467004 CTTGAAAAGTTTTTCTCAGTGGG - Intergenic
1157480867 18:48052826-48052848 ATTGAAATGGATTCATGTGTGGG - Intronic
1158100102 18:53820857-53820879 CCTGATAAGGTTTCCTTTGTAGG - Intergenic
1158418481 18:57271519-57271541 ATTTAAAAGGTTTCTTCTGGGGG - Intergenic
1159024819 18:63173937-63173959 ATAGAAAGGGTTTCCTCACTTGG + Intronic
1160061509 18:75533039-75533061 TTTGAAATAGTTTACTCTGTGGG - Intergenic
1162082588 19:8227235-8227257 AATGAAAAGATTTCCACTGAAGG - Intronic
1163174849 19:15557077-15557099 ATTGAGGAAGTTTCCACTGTGGG - Intergenic
1163979529 19:20885973-20885995 AGTGAACGGGTTTCCACTGTGGG - Intergenic
1164475817 19:28575267-28575289 AGTGAACAGGTTCCCACTGTGGG + Intergenic
1164475841 19:28575415-28575437 AGTGAACAGGTTCCCACTGTGGG + Intergenic
1164475863 19:28575559-28575581 AGTGAACAGGTTCCCACTGTGGG + Intergenic
1164475877 19:28575631-28575653 AGTGAACAGGTTCCCACTGTGGG + Intergenic
1164475906 19:28575813-28575835 AGTGAACAGGTTTCCACTGTGGG + Intergenic
1166594502 19:44033663-44033685 ATTGAAAAGGTTGACTTTGCAGG - Intergenic
926413009 2:12624643-12624665 CTTGCAAAGCTGTCCTCTGTGGG - Intergenic
926451492 2:13009694-13009716 ACTGAATAAGTGTCCTCTGTAGG - Intergenic
926553889 2:14333809-14333831 ATTTAATTGGTTACCTCTGTGGG - Intergenic
930315387 2:49791350-49791372 TTTAAAAAGGTTTGCTCGGTCGG + Intergenic
930393554 2:50790997-50791019 ATTTTTAAGGTTTCCTTTGTTGG + Intronic
933490432 2:82978994-82979016 ATTGTAATGATTTCCTCTGGTGG + Intergenic
935246726 2:101225228-101225250 AGAGAAAACCTTTCCTCTGTGGG - Intronic
935451845 2:103218707-103218729 ATAGAAAAGGTTTGCTCTCTGGG + Intergenic
935819876 2:106884245-106884267 AGGGAAAAGGTTTACTCTGTGGG - Intronic
936232661 2:110717325-110717347 AATAAAAAGGTTTCTTCTTTGGG + Intergenic
936844865 2:116818782-116818804 ACTGAAATGGTTTTCTCTCTAGG - Intergenic
937758790 2:125574441-125574463 AATGGAAAGTTTTCCTCTCTAGG - Intergenic
938914499 2:135922789-135922811 TTTGAGAAGGTTTTCTCTATTGG - Exonic
939709240 2:145495379-145495401 CATGAAAAGATTACCTCTGTTGG + Intergenic
939866995 2:147483738-147483760 ATTGTAAAGGTCTCCTCTTATGG - Intergenic
941194412 2:162430361-162430383 ATTCAAAAGGATACCTATGTAGG + Intronic
941253616 2:163199377-163199399 TTTTAAAAAGCTTCCTCTGTAGG + Intergenic
942120689 2:172773667-172773689 ATTGAAAAGGTTTAGGCTGTTGG - Intronic
943824473 2:192371847-192371869 ATTGAAAATGATTGCTTTGTTGG + Intergenic
944966837 2:204944713-204944735 TTTGAAAAGGTTTGCTATTTTGG + Intronic
945051232 2:205826079-205826101 AATGAAGAGGTCTCCTGTGTAGG - Intergenic
945476046 2:210284315-210284337 AAAGAAAAGCTTTCATCTGTAGG + Intergenic
1169126418 20:3130685-3130707 AGTGAAAAGCTTTCCTATATAGG - Intronic
1169954116 20:11082400-11082422 CTTGTCTAGGTTTCCTCTGTAGG + Intergenic
1173470166 20:43317420-43317442 AATGAAAAGGCTACCACTGTGGG + Intergenic
1175040331 20:56043632-56043654 ATTGAAATGGCTTTGTCTGTTGG - Intergenic
1178661929 21:34514121-34514143 ATTGAAAGTGTTTCTTCAGTAGG + Intronic
1179358251 21:40682156-40682178 ATGGGGAAGGTTTCCTTTGTTGG + Intronic
1179818298 21:43922093-43922115 ATGGAAAAGGTTTCCTTTTTTGG + Intronic
949370782 3:3332649-3332671 TTTGCAAAGGCTTGCTCTGTGGG - Intergenic
950331655 3:12160463-12160485 AATGAAAAGGTATCCTTTGAAGG - Intronic
952827962 3:37539788-37539810 ATTGAGCAGGTTACCACTGTGGG + Intronic
956590283 3:70907412-70907434 AATCCAAAGGATTCCTCTGTAGG - Intergenic
956617244 3:71184612-71184634 TTGGAAAAGGGTTCCTCTTTTGG - Intronic
956766230 3:72486915-72486937 AATGACAAGGTTGCCTCTGGTGG + Intergenic
957281625 3:78157238-78157260 TCTGACAAGTTTTCCTCTGTAGG - Intergenic
957595949 3:82266454-82266476 AGTGAAAAGTTTACCTCTCTGGG - Intergenic
960614993 3:119588334-119588356 AATGAGCAGGTTTCCACTGTGGG + Exonic
962186771 3:133268684-133268706 ATTCAGTAGGTTTCCTCTGCTGG - Intronic
965495823 3:169397781-169397803 AGTAGAAAGGATTCCTCTGTGGG + Intronic
965783541 3:172313174-172313196 ATGTAAAAGGATTCCTGTGTTGG - Intronic
966418425 3:179714039-179714061 AACAAAAAGCTTTCCTCTGTGGG + Intronic
967196041 3:187026514-187026536 ACTTAAAAGGTTGCCTCTGCAGG - Intronic
969250139 4:5962297-5962319 ACTGGAAACCTTTCCTCTGTTGG - Intronic
969665673 4:8555978-8556000 CTTGAAATGGTTTCCTCTGCAGG - Intergenic
970063732 4:12067244-12067266 ATTGAAAAGGAATTGTCTGTGGG + Intergenic
970070322 4:12151137-12151159 ATTGAAAATGGTTTCGCTGTAGG + Intergenic
970332320 4:15000014-15000036 AATGAAAAGGTTTCCTAGGGTGG - Intergenic
970350290 4:15195373-15195395 GTTGACAAGGCTACCTCTGTGGG + Intergenic
970381059 4:15508225-15508247 ATTGACAAGGCTACCACTGTGGG - Intronic
970485931 4:16524841-16524863 ATTGCAAAGGGTTCCTATGCTGG - Intronic
971702177 4:29992671-29992693 ATTGAAAATGTTTAGGCTGTTGG - Intergenic
972556591 4:40188007-40188029 AAGGAAAAGGTTTCTTCTGGAGG + Intergenic
973155107 4:46941856-46941878 GCTTAAAAGGTTTCCTCTGGGGG + Intronic
974084709 4:57247342-57247364 ATTGTGAAGATTTTCTCTGTAGG - Intergenic
974580834 4:63799165-63799187 AATGAAAAGTTTTCCAGTGTGGG + Intergenic
975942975 4:79669695-79669717 TCTGAAAAGTTTTCCTCTATAGG - Intergenic
976458161 4:85274413-85274435 ATAGATAGGGTTTCCTCTGATGG + Intergenic
976526260 4:86093227-86093249 CTGGAAAATGTTTCCTCTCTGGG + Intronic
977083602 4:92565452-92565474 ATTTAAAATATTTCCCCTGTGGG - Intronic
980010078 4:127585073-127585095 ATTTAAAAGGTTGTGTCTGTTGG - Intergenic
981938845 4:150260617-150260639 CATGACAAGGTTTCCTCTTTTGG + Intergenic
983228597 4:165108067-165108089 ATTGCAAATTTTACCTCTGTGGG + Intronic
984832715 4:183990516-183990538 ATTGAAAGGGTTCCATGTGTAGG - Intronic
985191416 4:187377803-187377825 TTTGAAATTCTTTCCTCTGTGGG - Intergenic
986111724 5:4725633-4725655 ATTGCAGAGGTTCACTCTGTGGG - Intergenic
986408489 5:7451176-7451198 ATAGACAAGGATTCTTCTGTTGG + Intronic
987658936 5:20846743-20846765 TGTGAACATGTTTCCTCTGTGGG - Intergenic
987933729 5:24435693-24435715 ATTTCAAAGCTTTCCTCTTTGGG - Intergenic
989109415 5:37892786-37892808 ATTGAAAAAGTCTCCACAGTGGG + Intergenic
989647795 5:43654892-43654914 AAGGAAAATGTTTGCTCTGTAGG + Intronic
989799181 5:45514702-45514724 ATTGAAAAGGTTTCCTCTGTAGG - Intronic
990404071 5:55470143-55470165 AATGGAAAGGGTTCCTCTGTTGG - Intronic
993859590 5:93119026-93119048 ATTGAAAAGGTAACCTTTGCGGG - Intergenic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
996758547 5:126962504-126962526 AATGAAAAAGTTTCCTATTTTGG - Intronic
997335815 5:133108492-133108514 ATTGAGAAGTTTTCCTGGGTGGG + Intergenic
998766871 5:145498019-145498041 ATTCAAAAGCCTCCCTCTGTGGG + Intronic
999641135 5:153674386-153674408 ATTGAGTAGGTTTCATCTGGTGG + Intronic
999648695 5:153744534-153744556 TTTGTAACGCTTTCCTCTGTAGG - Intronic
1002895303 6:1376549-1376571 AATGGAAAGGTTTCCTGTCTTGG + Intergenic
1004453774 6:15771966-15771988 ATTGTAAAGCTTTCTTCTGGAGG + Intergenic
1005245913 6:23885030-23885052 ATAGTAAAGGTTTGCTGTGTGGG - Intergenic
1005279823 6:24261625-24261647 ATTGAAAAAGTTACTCCTGTGGG - Intronic
1006725252 6:36195613-36195635 TTTGAAAGTGTTTCCTCTGCTGG - Intergenic
1008265504 6:49420434-49420456 ATTGATCAAGTTTCCTCTGTAGG - Intergenic
1009065404 6:58554944-58554966 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009065844 6:58561057-58561079 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009067156 6:58579408-58579430 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009068038 6:58591641-58591663 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009068705 6:58600813-58600835 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009068922 6:58603851-58603873 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009069140 6:58606908-58606930 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009069578 6:58613022-58613044 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009070665 6:58628302-58628324 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009071101 6:58634397-58634419 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009071759 6:58643569-58643591 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009072849 6:58658855-58658877 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009073287 6:58664970-58664992 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009073507 6:58668027-58668049 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009073728 6:58671082-58671104 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009073947 6:58674139-58674161 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009074167 6:58677196-58677218 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009074389 6:58680253-58680275 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009075266 6:58692481-58692503 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009075920 6:58701651-58701673 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009076570 6:58710823-58710845 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009076793 6:58713881-58713903 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009077011 6:58716938-58716960 AAAGAAAAGTTTTCCTCTGTGGG - Intergenic
1009077235 6:58719997-58720019 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009078551 6:58738341-58738363 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009078768 6:58741378-58741400 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009078992 6:58744437-58744459 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009079433 6:58750552-58750574 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009080271 6:58762276-58762298 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009080493 6:58765334-58765356 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009080713 6:58768391-58768413 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009080930 6:58771428-58771450 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009081150 6:58774485-58774507 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009081370 6:58777542-58777564 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009082462 6:58792831-58792853 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009082900 6:58798946-58798968 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009083122 6:58802005-58802027 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009084439 6:58820327-58820349 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009084661 6:58823386-58823408 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009085104 6:58829502-58829524 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009085325 6:58832559-58832581 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009086196 6:58844769-58844791 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009086853 6:58853942-58853964 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009087073 6:58856999-58857021 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009087949 6:58869209-58869231 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009088169 6:58872269-58872291 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009088388 6:58875326-58875348 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009089481 6:58890574-58890596 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009089699 6:58893631-58893653 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009090361 6:58902806-58902828 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009090582 6:58905863-58905885 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009090802 6:58908920-58908942 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009091018 6:58911977-58911999 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009091238 6:58915034-58915056 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009091674 6:58921148-58921170 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009092331 6:58930299-58930321 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009092770 6:58936414-58936436 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009093428 6:58945586-58945608 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009094514 6:58960873-58960895 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009094735 6:58963930-58963952 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009094957 6:58966987-58967009 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009095612 6:58976158-58976180 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009096269 6:58985333-58985355 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009096490 6:58988390-58988412 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009096710 6:58991447-58991469 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009096935 6:58994505-58994527 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009097155 6:58997562-58997584 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009097375 6:59000617-59000639 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009097595 6:59003673-59003695 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009097819 6:59006729-59006751 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009098476 6:59015899-59015921 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009099134 6:59025047-59025069 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009099579 6:59031158-59031180 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009100018 6:59037270-59037292 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009100457 6:59043386-59043408 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009100678 6:59046444-59046466 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009100901 6:59049501-59049523 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009101119 6:59052559-59052581 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009101557 6:59058673-59058695 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009101778 6:59061733-59061755 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009101998 6:59064790-59064812 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009102218 6:59067848-59067870 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009102651 6:59073962-59073984 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009102875 6:59077019-59077041 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009103537 6:59086169-59086191 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009103759 6:59089227-59089249 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009104642 6:59101456-59101478 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009104866 6:59104513-59104535 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009105084 6:59107569-59107591 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009105263 6:59110117-59110139 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009105695 6:59116231-59116253 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009106352 6:59125403-59125425 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009106573 6:59128461-59128483 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009107013 6:59134568-59134590 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009107234 6:59137627-59137649 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009107452 6:59140686-59140708 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009107673 6:59143723-59143745 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009108338 6:59152896-59152918 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009108557 6:59155955-59155977 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009108777 6:59159013-59159035 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009109432 6:59168185-59168207 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009110087 6:59177354-59177376 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009110307 6:59180411-59180433 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009111180 6:59192616-59192638 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009111617 6:59198734-59198756 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009113155 6:59220112-59220134 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009113373 6:59223170-59223192 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009113806 6:59229280-59229302 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009114026 6:59232339-59232361 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009114466 6:59238457-59238479 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009114687 6:59241514-59241536 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009115342 6:59250686-59250708 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009116005 6:59259861-59259883 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009116227 6:59262919-59262941 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009116452 6:59265976-59265998 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009116837 6:59271243-59271265 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009117278 6:59277358-59277380 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009118151 6:59289588-59289610 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009118636 6:59296339-59296361 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009118855 6:59299388-59299410 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009119078 6:59302445-59302467 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009119517 6:59308540-59308562 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009119734 6:59311598-59311620 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009120129 6:59317203-59317225 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009120351 6:59320258-59320280 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009120570 6:59323316-59323338 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009120789 6:59326373-59326395 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009121008 6:59329432-59329454 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009121431 6:59335374-59335396 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009123640 6:59365917-59365939 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009123863 6:59368975-59368997 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009124306 6:59375089-59375111 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009124742 6:59381203-59381225 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009125181 6:59387319-59387341 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009125838 6:59396473-59396495 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009126495 6:59405646-59405668 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009126781 6:59409729-59409751 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009127601 6:59420938-59420960 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009128476 6:59433167-59433189 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009129587 6:59448646-59448668 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009129809 6:59451704-59451726 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009130031 6:59454761-59454783 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009130472 6:59460876-59460898 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009130693 6:59463933-59463955 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009131567 6:59476165-59476187 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009132010 6:59482282-59482304 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009133113 6:59497741-59497763 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009133332 6:59500798-59500820 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009134214 6:59513027-59513049 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009134656 6:59519144-59519166 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009135586 6:59532069-59532091 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009136028 6:59538184-59538206 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009136680 6:59547361-59547383 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009136898 6:59550418-59550440 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009137119 6:59553473-59553495 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009137554 6:59559588-59559610 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009137999 6:59565703-59565725 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009138443 6:59571803-59571825 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009138662 6:59574861-59574883 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009139035 6:59580130-59580152 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009139257 6:59583189-59583211 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009139922 6:59592363-59592385 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009140146 6:59595421-59595443 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009141023 6:59607654-59607676 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009141680 6:59616822-59616844 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009141903 6:59619879-59619901 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009142340 6:59625973-59625995 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009142560 6:59629011-59629033 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009142784 6:59632071-59632093 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009143004 6:59635128-59635150 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009143226 6:59638165-59638187 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009143451 6:59641222-59641244 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009143892 6:59647337-59647359 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009144114 6:59650395-59650417 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009144777 6:59659568-59659590 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009144995 6:59662605-59662627 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009145217 6:59665662-59665684 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009145435 6:59668719-59668741 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009145871 6:59674828-59674850 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009146314 6:59680946-59680968 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009146755 6:59687060-59687082 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009147409 6:59696232-59696254 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009147633 6:59699289-59699311 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009148075 6:59705402-59705424 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009148297 6:59708459-59708481 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009148517 6:59711515-59711537 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009148733 6:59714572-59714594 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009149604 6:59726800-59726822 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009150260 6:59735965-59735987 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009151579 6:59754314-59754336 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009151798 6:59757371-59757393 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009152459 6:59766542-59766564 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009152677 6:59769598-59769620 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009152893 6:59772655-59772677 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009153554 6:59781827-59781849 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009153778 6:59784885-59784907 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009154229 6:59791002-59791024 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009154455 6:59794060-59794082 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009154676 6:59797117-59797139 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009156438 6:59821820-59821842 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1009156872 6:59827934-59827956 AAAGAAAAGTTTTACTCTGTGGG - Intergenic
1010365819 6:75049974-75049996 AGAGAAAAGGTTCCCACTGTGGG + Intergenic
1012431138 6:99164603-99164625 ATTTAAAAGGCTGCCTCTGTAGG - Intergenic
1014588554 6:123232236-123232258 TTTGAAATGTTTTCCTCTCTTGG - Intronic
1015137153 6:129885911-129885933 ATTGAGATTGTTTCCTCTATGGG + Intergenic
1015947928 6:138521991-138522013 GCTGAAACAGTTTCCTCTGTTGG - Intronic
1016103568 6:140133546-140133568 ATTCAAAATGTTGCCTCTTTAGG - Intergenic
1017167365 6:151421981-151422003 CTTCAAATTGTTTCCTCTGTTGG - Intronic
1017647642 6:156553826-156553848 ATTAAAAAGGTCTCTTTTGTTGG - Intergenic
1017690472 6:156959096-156959118 AATGAAATGTTTTCCTCTATTGG + Intronic
1017965987 6:159266442-159266464 TTTTAAAAGGTTTACTATGTTGG + Intronic
1020542563 7:9477476-9477498 AGTAAAAAGATTTCCACTGTGGG - Intergenic
1020597864 7:10232173-10232195 ATTAAAAACATCTCCTCTGTGGG - Intergenic
1020838268 7:13182308-13182330 ATTGAGATGTTTTCCTCTTTTGG - Intergenic
1024702184 7:51916062-51916084 ATAAAGAAGGTTGCCTCTGTAGG + Intergenic
1027908112 7:84212617-84212639 CTAGAAAGTGTTTCCTCTGTTGG + Intronic
1028681296 7:93536516-93536538 AATAAAAAGGTTTCCTCTTGGGG - Intronic
1030382069 7:108823330-108823352 ATTGTACAGTTTTCATCTGTGGG + Intergenic
1031121026 7:117722235-117722257 ATGCAAAAGGATTCCTGTGTTGG + Intronic
1031520785 7:122762990-122763012 ATTGAAACTGGTTGCTCTGTAGG - Intronic
1031937840 7:127754157-127754179 ATAGAAAATGATTTCTCTGTTGG + Intronic
1032927618 7:136626171-136626193 ATTGAAAAATTTTCCTCAGCTGG + Intergenic
1035189980 7:157158285-157158307 ATAGAATAGGTTCCCTCTCTCGG - Intronic
1038971929 8:32646464-32646486 GTTGAAAAGCTTACCTCTCTAGG + Intronic
1039702275 8:39974424-39974446 ATCAAAAATGTTTCATCTGTTGG + Intronic
1039997734 8:42548693-42548715 TCTGACAAAGTTTCCTCTGTAGG - Exonic
1042145016 8:65719139-65719161 ATTTCCAAGATTTCCTCTGTTGG - Exonic
1042849860 8:73205927-73205949 TGAGAAAAGGTCTCCTCTGTTGG + Intergenic
1044080711 8:87879596-87879618 AATGAAAAGGTCACCTCTCTTGG + Intergenic
1044891360 8:96839538-96839560 ATAGAGAAGCTTTCCTCTGTGGG - Intronic
1050786626 9:9411833-9411855 TTTGAAAAGATTTTCTGTGTAGG + Intronic
1051794784 9:20854112-20854134 TTTATAAAGCTTTCCTCTGTTGG + Intronic
1054718828 9:68583482-68583504 AGAGACAAGGTTTCCTATGTTGG - Intergenic
1054745258 9:68847641-68847663 ATTGAAAAGGTGTCCTATATGGG - Intronic
1057644323 9:96858970-96858992 AGTGTAAATGTTTCCTCCGTGGG - Intronic
1057644342 9:96859063-96859085 AGTGTAAATGTTTCCTCTGTGGG - Intronic
1059811467 9:117860188-117860210 ATTCTGAAGGTTTCATCTGTTGG - Intergenic
1061717638 9:132530745-132530767 ATTAAAAACGTTTGCTCTGTGGG - Intronic
1186219109 X:7330641-7330663 ATTGAAAAGGTCTTCTCTAGTGG - Intronic
1187029999 X:15476515-15476537 ATTCAAAAGTTTACCTCTGAAGG + Intronic
1187833669 X:23408845-23408867 AATGAACAGGTTACCTCTATGGG + Intergenic
1189436500 X:40997407-40997429 ATTAAAAACCATTCCTCTGTGGG - Intergenic
1189579991 X:42396035-42396057 AATGAGAGGGTTACCTCTGTGGG + Intergenic
1190319343 X:49171075-49171097 ATTGAAAAGTGTTCCTCGGCTGG - Intergenic
1190632399 X:52400579-52400601 ATTGATTAGGCTTCTTCTGTGGG + Intergenic
1191215216 X:57926349-57926371 ATTGTAAAGGTATACACTGTGGG - Intergenic
1193570092 X:83130412-83130434 ACTGATGAGGTTTCCTTTGTAGG - Intergenic
1194804354 X:98308833-98308855 ATTAAATAGTTGTCCTCTGTAGG + Intergenic
1197161640 X:123329862-123329884 TTTGAAAAGGTTGCCTCTCTGGG + Intronic
1197325857 X:125092268-125092290 ATTGAATAGCTTACTTCTGTTGG - Intergenic
1199400332 X:147391214-147391236 CTTGATAAGGTTCCCTTTGTAGG - Intergenic
1200286867 X:154831148-154831170 ATTGAAAAGGTATCAGGTGTAGG - Intronic