ID: 989800719

View in Genome Browser
Species Human (GRCh38)
Location 5:45535305-45535327
Sequence ATAGAGAAGCAGGCTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2605
Summary {0: 1, 1: 2, 2: 30, 3: 344, 4: 2228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989800719 Original CRISPR ATAGAGAAGCAGGCTGGGCA TGG Intronic
Too many off-targets to display for this crispr