ID: 989803810

View in Genome Browser
Species Human (GRCh38)
Location 5:45579962-45579984
Sequence GGAAGGATATTGCATCTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989803810_989803811 -8 Left 989803810 5:45579962-45579984 CCATTTAGATGCAATATCCTTCC 0: 1
1: 0
2: 0
3: 18
4: 204
Right 989803811 5:45579977-45579999 ATCCTTCCACCACATTCCTCTGG 0: 1
1: 0
2: 3
3: 22
4: 209
989803810_989803816 18 Left 989803810 5:45579962-45579984 CCATTTAGATGCAATATCCTTCC 0: 1
1: 0
2: 0
3: 18
4: 204
Right 989803816 5:45580003-45580025 ATTAATTGAAAGATATATACTGG 0: 1
1: 0
2: 0
3: 37
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989803810 Original CRISPR GGAAGGATATTGCATCTAAA TGG (reversed) Intronic
901485692 1:9559394-9559416 AGGAAGATATTGCATATAAAGGG + Intronic
904342053 1:29842534-29842556 AGAAGGACATTGAACCTAAAAGG + Intergenic
905316801 1:37087393-37087415 GGAAGTAAATTGCAGCAAAATGG - Intergenic
905785314 1:40751365-40751387 GGAAGGATATTGACTGGAAAGGG + Intronic
906385311 1:45363551-45363573 GGAAGGATATTAGAGGTAAAGGG - Intronic
906451567 1:45953632-45953654 GGAAGGACATTGCAAGTAAAGGG + Intronic
908883629 1:68761411-68761433 AAAAGGATATTGCATGCAAATGG + Intergenic
910234606 1:85022810-85022832 GCAAGGATATTGCATCTGGCTGG + Intronic
910620908 1:89253524-89253546 GGAAAGATATTCCATCTTCATGG + Intergenic
911012259 1:93293139-93293161 GGAAAGATATTCCATGTTAATGG + Intergenic
915078447 1:153332116-153332138 AGAAAGATATTTCATGTAAATGG + Intronic
915566686 1:156718078-156718100 GCCAAGATATTGCGTCTAAAGGG + Intergenic
916403076 1:164469768-164469790 GGAAAGAGATTGCAACCAAAAGG - Intergenic
916476279 1:165172207-165172229 GGAAGGAATTTACATCTAACTGG + Intergenic
921315868 1:213889824-213889846 TGAATAATATTGCCTCTAAAAGG - Intergenic
922365927 1:224863708-224863730 GGAAGGATATTCCACCCATAGGG - Intergenic
924850223 1:247821591-247821613 GACAGGATATTCCATCCAAATGG - Intergenic
924949520 1:248869589-248869611 GGAAAGATATTTCATTTTAATGG + Intergenic
1065349790 10:24785224-24785246 GGAAAGATATTGCAGGTAGAGGG + Intergenic
1065907028 10:30264823-30264845 GGAAGGATATTTCATGTTCATGG + Intergenic
1066526844 10:36289745-36289767 GGAAAGATATTGCATGTTTATGG - Intergenic
1068183039 10:53546706-53546728 GGAAGGGTGGTGCATCTCAAAGG - Intergenic
1077859644 11:6165090-6165112 GGAAGGATATTCCATGTTCATGG + Intergenic
1078115320 11:8443388-8443410 GGTAGGTGATTGCATCTTAAAGG - Intronic
1079305090 11:19314920-19314942 AGAAGCATCTTGAATCTAAAAGG + Intergenic
1079572228 11:21957924-21957946 GGAAGGATATTTCATGTTCATGG + Intergenic
1080326756 11:31083524-31083546 GGATGTATGTTCCATCTAAAGGG + Intronic
1083549682 11:63577674-63577696 GACAGCATATTGCATCCAAAAGG + Intronic
1086517367 11:87628313-87628335 GGCAGGATATTGCAGCTATAAGG - Intergenic
1086880171 11:92144269-92144291 TAAAGGATATTTCATATAAATGG - Intergenic
1088033926 11:105288502-105288524 GCAAGGATATTTCACTTAAAAGG + Intergenic
1088196914 11:107284393-107284415 GGCAGAATATTGGTTCTAAAAGG + Intergenic
1089649727 11:119904942-119904964 GGAAGTATCTTGAATCTAAAAGG - Intergenic
1090479002 11:127051374-127051396 GGATGGATTCTGCAACTAAATGG - Intergenic
1090495734 11:127210243-127210265 TGATAGATATTGCATCAAAAAGG - Intergenic
1091467038 12:693839-693861 GGAAGCAAATTGCGTCTCAAAGG + Intergenic
1093398269 12:18710323-18710345 GGAAGAGTATTTCATATAAAGGG + Intronic
1098118527 12:67208349-67208371 GGAAGCATATTGGATGTTAAAGG - Intergenic
1098332748 12:69371931-69371953 GGAAGGATATTATATGTAGAGGG + Intronic
1104103435 12:125636638-125636660 GGAAACTCATTGCATCTAAAGGG - Intronic
1109257720 13:60103464-60103486 GGAAGGATATTCAACCAAAAAGG + Intronic
1110140376 13:72121904-72121926 GTAAGTTTATTTCATCTAAATGG - Intergenic
1110633961 13:77743774-77743796 GTAAGAATATCACATCTAAAAGG - Intronic
1111414980 13:87928503-87928525 GGAAAGATATTCCATGTTAATGG + Intergenic
1113329656 13:109316003-109316025 GGAAGGAGACTTCATCTAGATGG - Intergenic
1113346138 13:109480327-109480349 GGAAGGATATTGCAGCCCCATGG + Intergenic
1115393024 14:32875478-32875500 GAAAAGATATTGCATGCAAATGG - Intergenic
1115435679 14:33370349-33370371 GGAAGAATATTCCAACCAAAGGG + Intronic
1115437379 14:33390646-33390668 GGAAGGAAAATGCATTTAGATGG - Intronic
1116346358 14:43799985-43800007 GGAAAAAGAATGCATCTAAATGG + Intergenic
1116650494 14:47585649-47585671 GGAAGTATAAGGCATCTAATAGG + Intronic
1117842616 14:59875754-59875776 GGAAGGATATTCCATGTTCATGG - Intergenic
1120359498 14:83480242-83480264 GTAAATATATTGCATCAAAATGG + Intergenic
1123479583 15:20618443-20618465 GGAAGGTTATTCCAGGTAAAAGG - Intergenic
1123638424 15:22381921-22381943 GGAAGGTTATTCCAGGTAAAAGG + Intergenic
1123692525 15:22850450-22850472 GGAACGATAATGCACCTTAATGG + Intronic
1124034447 15:26041646-26041668 GGAAAGATATTCCATGTTAATGG - Intergenic
1125090826 15:35790577-35790599 GGAAAGATATTCCATACAAACGG - Intergenic
1128267673 15:66280821-66280843 TGATGGACATTGCATCTAAAAGG + Intergenic
1128605041 15:69030738-69030760 AGAAGGAAATTGCATATACATGG - Intronic
1130842830 15:87717618-87717640 GGAAGCAGATTGCATCTGGAAGG - Intergenic
1134331801 16:13258414-13258436 TGAAGGATATGGCATATAACAGG + Intergenic
1134860384 16:17555393-17555415 GGAAGGCTATGGCATCTGGAAGG - Intergenic
1135090993 16:19517287-19517309 GGAAGGAAAATGAATCAAAAAGG - Intronic
1136646810 16:31627166-31627188 GAAAGGATATTCCATACAAATGG + Intergenic
1138531747 16:57638247-57638269 GGAAGGGTATGGAATTTAAATGG - Intronic
1138896774 16:61215342-61215364 TGCAGGAAATTTCATCTAAAAGG + Intergenic
1139426881 16:66886383-66886405 GTTAGGATATTGCATAGAAAAGG - Exonic
1140139013 16:72236934-72236956 GAAAGTATTTTGCATATAAAAGG - Intergenic
1140297994 16:73727308-73727330 GGAAGAATATTTCTTCTCAATGG - Intergenic
1142937952 17:3352873-3352895 GGAAAGATATTGCATGTTTATGG - Intergenic
1143506502 17:7368697-7368719 GGAAGGAAATTACATCACAAAGG - Intergenic
1144614339 17:16755073-16755095 GGAAGGATATTCCATGCAAATGG - Intronic
1144898368 17:18560602-18560624 GGAAGGATATTCCATGCAAATGG + Intergenic
1145134006 17:20385118-20385140 GGAAGGATATTCCATGCAAATGG - Intergenic
1149675316 17:58454845-58454867 GGAAGGATATCGCATGTGCATGG + Intronic
1150097172 17:62387566-62387588 GGAGGGAAATTGCTTTTAAATGG + Intronic
1150905988 17:69338052-69338074 AGAAGGAAATTGAATCCAAAAGG + Intergenic
1153544341 18:6190864-6190886 GGAAGAATATTACAGCCAAAGGG + Intronic
1153545493 18:6200755-6200777 GTAAGCATATTGCTTCTTAAAGG + Intronic
1153940615 18:9973598-9973620 GGAAGGATTTTGCATAGAATGGG + Intergenic
1156842281 18:41623436-41623458 GGATGGACATTGCACCTAAGTGG + Intergenic
1159071766 18:63631222-63631244 GGAAAGTTATTGCATGCAAATGG + Intergenic
1159412492 18:68098446-68098468 GGAAGGATATGGCAGCGACAGGG - Intergenic
1163075071 19:14883114-14883136 GGAAGGACATTGCATGTTACAGG - Intergenic
1167487036 19:49768602-49768624 GGAAGGATCTGGCATGTAATAGG + Intronic
926640146 2:15226882-15226904 GGAAGTAAAAGGCATCTAAATGG - Intronic
927036522 2:19183294-19183316 AAAAGGATATTGCATGTCAATGG - Intergenic
928491596 2:31789733-31789755 GGAAGGATATTCCATGTTAATGG + Intergenic
928863605 2:35890848-35890870 GGAAAGATATTGCATGTTCATGG - Intergenic
931173175 2:59826504-59826526 GGAAGGATTTTGGAGCTTAAAGG + Intergenic
931307529 2:61045258-61045280 GGAAGGATATTTCACTTAATTGG - Intronic
933612019 2:84446041-84446063 GGAAGGATATTCCATGCAGAGGG - Intronic
935398853 2:102639514-102639536 GAAAGGATAATGCTGCTAAATGG - Intronic
937435243 2:121874564-121874586 GGAAGGGGATTGGATTTAAACGG + Intergenic
939329832 2:140743462-140743484 GAAAGGATATTGCTGCTAAAGGG - Intronic
940660858 2:156543602-156543624 GGAAGGCCATTGTGTCTAAAAGG + Intronic
941089981 2:161163523-161163545 GCAAGGGTATTGCTTCTACATGG + Intronic
941590055 2:167408885-167408907 GGAAAGATATTGCATGTTCATGG + Intergenic
944079025 2:195764749-195764771 GGAAAGATATTCCATGTCAATGG + Intronic
944356752 2:198798955-198798977 GGAAGGATATTACATTTTCATGG + Intergenic
945632733 2:212302823-212302845 GGAAAGATAATTCATTTAAATGG - Intronic
946513791 2:220389126-220389148 GGAAAGATATTCCATGTCAATGG - Intergenic
948926655 2:241102932-241102954 GGAAGGCTCTTGCTTATAAAGGG - Intergenic
1169740379 20:8887224-8887246 GGAACGATATTGCATGTTCATGG - Intronic
1170015087 20:11771423-11771445 GAAATGATATTGTATTTAAAGGG - Intergenic
1173763564 20:45586290-45586312 GGAAGGATTTAGGATCTATAGGG + Intergenic
1174761897 20:53214920-53214942 TGAAGGATGTGGCATTTAAAAGG + Intronic
1175520734 20:59601185-59601207 GGATGGACATTGCATATAACTGG + Intronic
1178737132 21:35162348-35162370 GGAAGGCCATTGGATCCAAAGGG + Intronic
1178753124 21:35323101-35323123 GGAAGGGTATTGCAGATAAAGGG + Intronic
1182201515 22:28575635-28575657 GGAATGATATTCCATGTACATGG - Intronic
1183612493 22:38919389-38919411 AGAAGGTTATTTCATCTACATGG + Intergenic
949700103 3:6746816-6746838 GGTGGGAGATTGGATCTAAAAGG - Intergenic
952989530 3:38819625-38819647 GAAAGGACATTTCATATAAATGG - Intergenic
953137574 3:40195736-40195758 TGAAGGAGATAGCATCAAAATGG - Intronic
953795021 3:45978418-45978440 GGAAGGATCCTGGCTCTAAAGGG - Intronic
954962440 3:54578194-54578216 AGAAGGAAATTGCATCTAGCTGG + Intronic
956711667 3:72043563-72043585 GGAAAGATCATGCATTTAAAAGG + Intergenic
957995512 3:87684515-87684537 GGAAGGTTAGAGCATCTCAAAGG + Intergenic
960398879 3:117171454-117171476 GGAAACACATTTCATCTAAAAGG - Intergenic
961981665 3:131085621-131085643 GCAAGGACATTTCAGCTAAATGG + Intronic
962192083 3:133321318-133321340 GGAAAGATATTCCATGCAAATGG + Intronic
962668502 3:137680519-137680541 GGAAGGATATTACATGTTCACGG + Intergenic
963655223 3:148039843-148039865 TAAAGGATATTTCATCAAAAAGG + Intergenic
965037714 3:163463645-163463667 GGAAAAAGATTGCATCCAAATGG - Intergenic
970828179 4:20303811-20303833 GGAAGAATATTCCAGCTAGATGG + Intronic
977341884 4:95769458-95769480 GGAAAGATATTTCATGTAAATGG + Intergenic
978743035 4:112160420-112160442 GGAAAGATATTGCATGTTCATGG + Intronic
978762030 4:112363358-112363380 GAAAAGATATTGCATGCAAATGG + Intronic
980885893 4:138761856-138761878 GGAAGGACATGGCATCCAGAAGG + Intergenic
981115331 4:140983657-140983679 GGAAAGAGATTGAAGCTAAAGGG + Intronic
981269138 4:142823360-142823382 GGAAGTATTTTACATCTTAATGG - Intronic
983909630 4:173223240-173223262 GGAAGTTTATTGCATTTAAAAGG - Intronic
984016379 4:174431981-174432003 GGAAGGATATTAAATATATACGG + Intergenic
984251502 4:177341642-177341664 GGTAAGATATTGAATTTAAAGGG + Exonic
985885822 5:2676860-2676882 GGAAAGTCATTGCTTCTAAAGGG - Intergenic
986259200 5:6128123-6128145 GGAAAGATATTCCATGCAAATGG + Intergenic
986282577 5:6335595-6335617 GGAAGGACATTTCATATACAGGG + Intergenic
986282749 5:6337002-6337024 GGAAGGACATTTCATATACAGGG - Intergenic
989377879 5:40784255-40784277 GGAATGCTATTGCATCTACATGG - Intronic
989459484 5:41681179-41681201 TCAAGGAGATTGGATCTAAAGGG + Intergenic
989803810 5:45579962-45579984 GGAAGGATATTGCATCTAAATGG - Intronic
990159883 5:52925883-52925905 GTAAGGATTTTGCATAGAAAGGG - Intronic
991359613 5:65805770-65805792 AGAAGGCTATTTCATCTACATGG - Intronic
991366890 5:65878064-65878086 GGAAGGTTGTTTCATCTACATGG - Intergenic
991458706 5:66833618-66833640 GAAAGGATATTGTAGGTAAACGG - Intronic
992799802 5:80285638-80285660 GGAAAGCTATTTCATCTTAATGG + Intergenic
992853645 5:80837602-80837624 GACTGGATATTGCATCTTAAAGG + Intronic
993469532 5:88289610-88289632 GGAAGGACTTAGCATCCAAAGGG + Intergenic
993571612 5:89546988-89547010 GAAAGAATATTGGATCTAATAGG + Intergenic
994059601 5:95459780-95459802 GGAAGGAAATGGCATTAAAAAGG + Intergenic
995784071 5:115809638-115809660 GGAAGGATGTTGCAAGTACAAGG - Intronic
996462587 5:123763714-123763736 GAAAAGATATTTCATCGAAATGG - Intergenic
996465003 5:123790195-123790217 AGAAGTATATTCCATCTAAAAGG - Intergenic
998289687 5:140901826-140901848 GGAAAGATATTGCATGTTTATGG - Intronic
999024554 5:148213120-148213142 GGATGGATATTGCATCCACAGGG + Intronic
1004296351 6:14415439-14415461 GGAAGGATATTTCAGATAAATGG - Intergenic
1006110067 6:31739031-31739053 GGGAGGATGGTGCATTTAAAGGG + Intronic
1006306415 6:33223180-33223202 GGAAAGATATTCCATGTTAATGG + Intergenic
1008300281 6:49829670-49829692 GGAAGGTTTTTGCATTTAAGTGG + Intergenic
1009528387 6:64777410-64777432 AGAAAGAAATGGCATCTAAAAGG + Intronic
1010251568 6:73712770-73712792 GGAAGGAGAAAGCATCTGAAAGG + Intronic
1010299269 6:74241064-74241086 AGAAAGATATTCCATGTAAATGG - Intergenic
1011013058 6:82723602-82723624 AGAAGGGTCTTGCCTCTAAATGG + Intergenic
1011398920 6:86938485-86938507 GAAAGGAAATTGAGTCTAAAGGG + Intronic
1011915574 6:92502098-92502120 GGAAAAATAATGCATTTAAAAGG - Intergenic
1012715518 6:102663818-102663840 GGAAAGATATTCCATGCAAATGG + Intergenic
1012844430 6:104371724-104371746 GGAAGTATTTTGAATCTTAAGGG - Intergenic
1014303989 6:119717272-119717294 GGTAGGATATGGCATGGAAAGGG - Intergenic
1015353747 6:132252743-132252765 AGAAGGAAATTCCATCTCAATGG + Intergenic
1015756940 6:136617097-136617119 GTAAGGATATTGCTTCTCCAGGG - Intronic
1016069692 6:139725216-139725238 GGAAAGAAATTGCAACAAAATGG - Intergenic
1018010984 6:159669791-159669813 AGAAAGATATTGCATACAAATGG - Exonic
1019860238 7:3652011-3652033 AGAAGGATACTGAATCTAGAAGG + Intronic
1020405061 7:7823793-7823815 GGAAGCATTTTTCACCTAAAGGG - Intronic
1020664022 7:11016889-11016911 GGAAGGATAGTGCAGGGAAAGGG - Intronic
1023157220 7:37263047-37263069 GGAAAAATATTGCATTAAAAGGG - Intronic
1024328277 7:48130925-48130947 GAGAGGATATTGGATCTGAAAGG + Intergenic
1027707924 7:81557215-81557237 AGAAGGGTATTGTAACTAAAGGG + Intergenic
1028598234 7:92570120-92570142 AGATGGATATTACATCTAAATGG - Intronic
1030319824 7:108154001-108154023 GGAAATAAATTGCAGCTAAAGGG - Intronic
1031270938 7:119648271-119648293 AGAATGATATCGCATCAAAAGGG + Intergenic
1033082510 7:138311540-138311562 GGATGGACATTGTATCTAACTGG - Intergenic
1033882094 7:145897756-145897778 GGAAGGATATTCCATGCTAATGG - Intergenic
1034190674 7:149210980-149211002 GCCAGGATATTGTTTCTAAAGGG - Intronic
1035084140 7:156242038-156242060 GGAAAGATATTTCATCTTCATGG - Intergenic
1041897333 8:62940061-62940083 GAAAAGATATTCCATGTAAATGG + Intronic
1042049585 8:64688993-64689015 GGAAGGATATTTAAACTTAATGG - Intronic
1044351089 8:91167400-91167422 GGAAGGATATTGAATCATAGGGG - Intronic
1045003118 8:97895418-97895440 GGAAGGATATTCCAGGTAGAAGG - Intronic
1045880594 8:107034089-107034111 GGAAAGATATCCCATGTAAAGGG + Intergenic
1046796320 8:118376674-118376696 GGAAGGATACTCCATCTCTATGG + Intronic
1047047984 8:121076193-121076215 GACAGGATATTACCTCTAAAAGG - Intergenic
1047342546 8:123996470-123996492 AAAAGGATATTCCATGTAAATGG - Intronic
1048190779 8:132286374-132286396 GGAAGGACATTAAATCTTAAAGG - Intronic
1050918849 9:11173148-11173170 GGGAGAATATTGTAGCTAAATGG - Intergenic
1051191381 9:14516624-14516646 GGAAAAAGATTGCATCTAATTGG - Intergenic
1051197906 9:14583947-14583969 GGAAGGATATTTCAGATGAATGG - Intergenic
1186229611 X:7439169-7439191 GGGAGGAGATGGCATCTACAAGG + Intergenic
1187106936 X:16253001-16253023 GGAAGATTAAAGCATCTAAAAGG + Intergenic
1188820002 X:34763504-34763526 GGTAAGATATTGCATTGAAATGG - Intergenic
1189124349 X:38430347-38430369 GGAAGAATATTTCAGCTAGAGGG + Intronic
1189873945 X:45415251-45415273 GGAAGGATATTCCATGCCAATGG - Intergenic
1191008345 X:55735453-55735475 GGAAGAATATTCCATGTTAATGG - Intronic
1191994146 X:67072489-67072511 GGAAAGACATTGCATGTCAATGG + Intergenic
1192688453 X:73332976-73332998 GGAAAGATATTTCATTCAAATGG - Intergenic
1193321328 X:80125025-80125047 GGAATGATATTCCATGTAGATGG - Intergenic
1193414613 X:81206707-81206729 GGAGGGATATTGTGTCTAAAAGG + Intronic
1194019894 X:88674807-88674829 AAAAAGATATTGCTTCTAAAAGG + Intergenic
1194372147 X:93087635-93087657 GAAAAGATATTCCATGTAAATGG - Intergenic
1194621658 X:96180484-96180506 GGAAAGATCTACCATCTAAATGG + Intergenic
1195370667 X:104169041-104169063 AGAAGGATAATACATTTAAAAGG - Intronic
1195662604 X:107395147-107395169 GGAAGGATATTCCATGTTCATGG - Intergenic
1196523101 X:116696633-116696655 AGTAGGATATGGGATCTAAAGGG + Intergenic
1196639681 X:118044245-118044267 GGAAAGATATTTCATCTTCATGG + Intronic
1197360866 X:125502153-125502175 CAAAGGATATTTCATATAAATGG - Intergenic
1197558519 X:127988772-127988794 GGAAGGAGTTTACAACTAAATGG - Intergenic
1197623175 X:128774260-128774282 GGAAAGATATTGCATGTTTATGG - Intergenic
1198441306 X:136666094-136666116 TGAAGGATGTTATATCTAAATGG + Exonic
1198612218 X:138414293-138414315 GAAAAGATATTCCATGTAAATGG + Intergenic
1200328841 X:155272983-155273005 GAAAGGATATTGCATATTCATGG - Intergenic
1200680200 Y:6201679-6201701 GAAAAGATATTCCATGTAAATGG - Intergenic