ID: 989805398

View in Genome Browser
Species Human (GRCh38)
Location 5:45597596-45597618
Sequence GGGGATTCAATTAGGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14306
Summary {0: 2, 1: 131, 2: 7924, 3: 3776, 4: 2473}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989805392_989805398 8 Left 989805392 5:45597565-45597587 CCAGGGCAATCAGGCAAGAGAAG 0: 135
1: 5628
2: 9345
3: 6039
4: 4541
Right 989805398 5:45597596-45597618 GGGGATTCAATTAGGAAAACAGG 0: 2
1: 131
2: 7924
3: 3776
4: 2473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989805398 Original CRISPR GGGGATTCAATTAGGAAAAC AGG Intronic
Too many off-targets to display for this crispr