ID: 989807266

View in Genome Browser
Species Human (GRCh38)
Location 5:45624740-45624762
Sequence AGATGTTTCTCATTCCCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 285}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989807266_989807270 5 Left 989807266 5:45624740-45624762 CCATTTGGGAATGAGAAACATCT 0: 1
1: 0
2: 4
3: 21
4: 285
Right 989807270 5:45624768-45624790 CCTGGGCCCTCTTGTGTTTATGG 0: 1
1: 0
2: 1
3: 7
4: 127
989807266_989807277 25 Left 989807266 5:45624740-45624762 CCATTTGGGAATGAGAAACATCT 0: 1
1: 0
2: 4
3: 21
4: 285
Right 989807277 5:45624788-45624810 TGGAGGCAAGCAGGGATGTAGGG 0: 1
1: 0
2: 1
3: 47
4: 569
989807266_989807275 17 Left 989807266 5:45624740-45624762 CCATTTGGGAATGAGAAACATCT 0: 1
1: 0
2: 4
3: 21
4: 285
Right 989807275 5:45624780-45624802 TGTGTTTATGGAGGCAAGCAGGG 0: 1
1: 1
2: 0
3: 27
4: 245
989807266_989807274 16 Left 989807266 5:45624740-45624762 CCATTTGGGAATGAGAAACATCT 0: 1
1: 0
2: 4
3: 21
4: 285
Right 989807274 5:45624779-45624801 TTGTGTTTATGGAGGCAAGCAGG No data
989807266_989807276 24 Left 989807266 5:45624740-45624762 CCATTTGGGAATGAGAAACATCT 0: 1
1: 0
2: 4
3: 21
4: 285
Right 989807276 5:45624787-45624809 ATGGAGGCAAGCAGGGATGTAGG 0: 1
1: 0
2: 2
3: 45
4: 575
989807266_989807271 8 Left 989807266 5:45624740-45624762 CCATTTGGGAATGAGAAACATCT 0: 1
1: 0
2: 4
3: 21
4: 285
Right 989807271 5:45624771-45624793 GGGCCCTCTTGTGTTTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989807266 Original CRISPR AGATGTTTCTCATTCCCAAA TGG (reversed) Intronic
900078866 1:840341-840363 ACATTTTTGTCATTCCCTAAGGG - Intergenic
900348665 1:2224490-2224512 AGATCTTTCAGATCCCCAAAAGG - Intergenic
905064678 1:35170308-35170330 AGATGTGTCTCAATTCCTAAAGG - Intergenic
908476105 1:64490191-64490213 ATATTTTTCAAATTCCCAAAGGG + Intronic
910060415 1:83085210-83085232 AGATGATTCTGATCCCCACATGG - Intergenic
910562725 1:88609640-88609662 ACATGGTTCTTATTCCCAAGGGG - Intergenic
910872237 1:91845281-91845303 ACATGTTGCTCAAGCCCAAAAGG + Intronic
911004691 1:93207745-93207767 ACATGTCTGTCATCCCCAAAAGG + Intronic
911795443 1:102070181-102070203 AAATGTTTCTCATGACCAAATGG + Intergenic
912154378 1:106899244-106899266 AGACGTTTCTCACAGCCAAAAGG + Intergenic
912388618 1:109285881-109285903 AGCTGTGCCTGATTCCCAAAGGG - Intergenic
912558218 1:110531455-110531477 AAATGTTTCTCATCCCAACATGG - Intergenic
912650923 1:111438681-111438703 AGGTGTCTCTCCTTCCCAACAGG - Intergenic
913330333 1:117661919-117661941 AGAAGTTACTCATCACCAAAGGG - Intergenic
915481327 1:156187865-156187887 CCATTTTTGTCATTCCCAAAAGG - Intergenic
916348045 1:163816608-163816630 CAAAGTTTCCCATTCCCAAATGG + Intergenic
917013449 1:170501981-170502003 AGATTTTTCTTTTTCCAAAAAGG + Intergenic
918083215 1:181223215-181223237 AGATGTTTCTCAGGCTCCAAGGG - Intergenic
919155566 1:193761304-193761326 AGCAATTTCTCATTCTCAAAAGG + Intergenic
919165217 1:193884274-193884296 AGTTGTTCCTCATTACCTAAAGG - Intergenic
920719536 1:208374412-208374434 AGGGGTCTCTCATTCCAAAATGG - Intergenic
921426335 1:215005397-215005419 TAATGTTTTCCATTCCCAAAAGG - Intergenic
922238095 1:223736484-223736506 AGATTTTCCACCTTCCCAAATGG - Intronic
924637349 1:245800754-245800776 AGATGTCTCTCATTCTCCCATGG - Intronic
1063062337 10:2569227-2569249 AAATGTGTCTCATTTTCAAAGGG - Intergenic
1063382478 10:5594569-5594591 AGAACTTTCTCAGCCCCAAAGGG + Intergenic
1064678226 10:17783055-17783077 AGAGGTTTCTGACTCCCACACGG - Intronic
1064963958 10:20996505-20996527 TGATGTTTATCTCTCCCAAAAGG - Intronic
1066236655 10:33491383-33491405 GGATTTTTCTCATTTCTAAATGG + Intergenic
1066815471 10:39403933-39403955 AGATATTTCTCTTTCCCCATAGG - Intergenic
1066932221 10:41777282-41777304 AGATGTTTCTTTTTCACAATTGG - Intergenic
1066972796 10:42329804-42329826 AGATATTTCTAATTCATAAATGG + Intergenic
1067301613 10:45015730-45015752 AGCTGCATTTCATTCCCAAAGGG - Intergenic
1068371620 10:56124523-56124545 AGATTTTGCACATTCTCAAAAGG + Intergenic
1068481353 10:57592041-57592063 AGATATTTTGCATTCTCAAATGG - Intergenic
1069317174 10:67120552-67120574 AGAAATTTCTGATCCCCAAATGG + Intronic
1070087268 10:73249704-73249726 AGCAGTTTCTCATTCTTAAAAGG + Exonic
1071202599 10:83236739-83236761 ATATGTGTCTCTTTCCCTAATGG + Intergenic
1072183554 10:93012082-93012104 AAAGGTTACTCATTCTCAAAAGG + Intronic
1072967361 10:99985608-99985630 AATGGATTCTCATTCCCAAAAGG - Intronic
1073406565 10:103303339-103303361 AGAAGTTACTCATTTCAAAATGG - Exonic
1074022551 10:109598548-109598570 ACATTTTTCTCATTGCCACATGG + Intergenic
1075807523 10:125200827-125200849 AGATTTTTCCCATCCCCAGAAGG - Intergenic
1076128908 10:127998107-127998129 AGATCTCTTTTATTCCCAAAGGG - Intronic
1076138782 10:128063636-128063658 AGCTGTTTCTAATTCAAAAAAGG + Intronic
1077944784 11:6884406-6884428 AGTTGTTTGTCACTCCTAAACGG + Intergenic
1078703490 11:13714790-13714812 AGAGGCTTCTCATTCACAAAAGG - Intronic
1078816325 11:14825829-14825851 ACATTTTTCTCATTGCCACATGG + Intronic
1080198420 11:29639114-29639136 ACATGTTTCTCTTTGCCTAAGGG - Intergenic
1080434454 11:32226686-32226708 AAATGTCTCCCATTCACAAAGGG - Intergenic
1080547904 11:33339488-33339510 AGATGTTTCATATTAACAAAAGG - Exonic
1083514558 11:63244556-63244578 AGGTGCTTCTCCGTCCCAAATGG - Intronic
1084747144 11:71180080-71180102 AGATGCTTGTCATTCCCAAGTGG - Intronic
1085242939 11:75073756-75073778 AGGTTTTCCTCATACCCAAAGGG + Intergenic
1085594190 11:77792785-77792807 AGATTTTTCTCACTTACAAAGGG - Intronic
1086328267 11:85726946-85726968 AGCTTTCTCTCCTTCCCAAAAGG + Intronic
1086778641 11:90873953-90873975 ACATTTTTATCATCCCCAAATGG - Intergenic
1086799047 11:91148630-91148652 AGATGTCTCTCCTTCCTAACTGG + Intergenic
1087107329 11:94423556-94423578 AGATGTTCCTCTGTCCCACAGGG - Intronic
1087256749 11:95964586-95964608 AGATGTTTCTAAACTCCAAAGGG + Intergenic
1088655834 11:111999142-111999164 AAATGTTTCTCATTCCCCTCTGG + Intronic
1091497340 12:984096-984118 AAATGTTTCTTCTTCCCAAACGG + Intronic
1091697325 12:2636702-2636724 TGAGGTTTCTCTTTACCAAAAGG - Intronic
1091920497 12:4300530-4300552 AGGTGCTTCTCCATCCCAAATGG - Exonic
1093851835 12:24049118-24049140 AGTTGTTTCTCATCTCCACAGGG - Intergenic
1093910421 12:24741183-24741205 AAATGTTTTTCTTTCCAAAATGG + Intergenic
1094436599 12:30427009-30427031 AGATTTTCCTCATTACCCAAAGG - Intergenic
1094798164 12:34000503-34000525 AGATGTGTCTCACTCTCATAGGG - Intergenic
1095933262 12:47650383-47650405 AGATGTTTAGCACTCACAAAAGG + Intergenic
1095946575 12:47757295-47757317 AGATGTTTCTCACTAGCAAAGGG + Intronic
1097118426 12:56716252-56716274 AGATGCTTCTCATTCCCCAAAGG - Intronic
1097520931 12:60670236-60670258 ACATTTTTCTCATTGCCACATGG - Intergenic
1099344823 12:81485532-81485554 AAATATTTTTCATTCACAAAAGG - Intronic
1100827710 12:98490357-98490379 AGATGTGCCTGAATCCCAAAGGG + Intronic
1102915238 12:116747617-116747639 AGATGTTATTCAGTCCGAAATGG - Intronic
1104258865 12:127164663-127164685 AGATGTTACTTTTCCCCAAATGG + Intergenic
1106360924 13:29029833-29029855 AGAACTTGCTCATTACCAAAAGG + Intronic
1107472748 13:40705541-40705563 AGATGTTTATCATTTAAAAAGGG + Intergenic
1107491304 13:40882021-40882043 AGATGTTTATCATTTACAAAGGG + Intergenic
1108715168 13:53071692-53071714 AGAATTTTCACATTCCCAGATGG + Intergenic
1109052692 13:57504942-57504964 AGAGGTTTCTCATTTCCCCATGG - Intergenic
1109265491 13:60194238-60194260 AGATCTTTCTTATTTCTAAATGG - Intergenic
1109679812 13:65735732-65735754 AGATTTTTCTCATTAACACATGG + Intergenic
1110879047 13:80547757-80547779 TGATATTTCTGATTTCCAAAAGG + Intergenic
1112218583 13:97462727-97462749 TCATGTTTCACATTGCCAAATGG + Intronic
1114012725 14:18388717-18388739 AGATATTTCTAATTCATAAATGG + Intergenic
1115044939 14:28980283-28980305 ACATTTTTCTCATTGCCACATGG + Intergenic
1115052613 14:29082454-29082476 AGATATTTTGCATTCCCAATAGG + Intergenic
1116570091 14:46505455-46505477 CCATGTTTCTCTTTCCTAAATGG - Intergenic
1116571072 14:46515931-46515953 AGATGTCTTTCATTTTCAAAAGG - Intergenic
1118429404 14:65701505-65701527 AGCTGATTCTCATTCTCTAAGGG + Intronic
1118432670 14:65736580-65736602 AAAAGTTCTTCATTCCCAAAAGG + Intronic
1118543864 14:66862629-66862651 AGATCATTCTCATAACCAAAAGG + Intronic
1119955600 14:78795637-78795659 AAATTTTTCTTAGTCCCAAATGG - Intronic
1120623491 14:86794364-86794386 AAATGTTTATAATACCCAAAGGG - Intergenic
1120723580 14:87914038-87914060 ACATTTTTCTCATTGCCACATGG - Intronic
1121162033 14:91752366-91752388 AGATAATTGTCATTCCCATATGG - Intronic
1122591445 14:102854943-102854965 ACATTTTTTTCGTTCCCAAAAGG + Intronic
1123504419 15:20925621-20925643 AGAGGTTCCTCATCCCCAGAAGG - Intergenic
1123561665 15:21499322-21499344 AGAGGTTCCTCATCCCCAGAAGG - Intergenic
1123597909 15:21936603-21936625 AGAGGTTCCTCATCCCCAGAAGG - Intergenic
1124441741 15:29690496-29690518 AGAAGTTTCTCATTTTTAAATGG + Intergenic
1125127486 15:36241161-36241183 ACATGTTTTTCATTCCGGAAGGG - Intergenic
1126263729 15:46727814-46727836 ATTTTTTTCTCATTTCCAAAAGG + Intergenic
1126989106 15:54350844-54350866 AGATGGTTTTCCTTCACAAATGG + Intronic
1127816198 15:62611300-62611322 AGGTGCTTCTGTTTCCCAAATGG - Intronic
1202970010 15_KI270727v1_random:226447-226469 AGAGGTTCCTCATCCCCAGAAGG - Intergenic
1137923647 16:52518037-52518059 GGATGTTTCAAATTCCAAAAGGG - Intronic
1138242117 16:55435692-55435714 AGATGCTTCTCATTCACACATGG - Intronic
1138898485 16:61239817-61239839 AGCTGTGCCTCATTTCCAAAAGG - Intergenic
1140585705 16:76289372-76289394 AGACTTTTCTCATTCACATAGGG + Intronic
1142045456 16:87922441-87922463 AGATGTTTCTGTATCCCCAAGGG - Intronic
1143492144 17:7290698-7290720 ACATGTTGCTCCTTCCCAAATGG - Intronic
1143752659 17:9041296-9041318 ACATTTTTGTCATCCCCAAAAGG + Intronic
1145716125 17:27023721-27023743 AAATCCTTCTCATTCCCCAACGG + Intergenic
1146099937 17:29971503-29971525 AAATGTTTTTCATATCCAAATGG - Intronic
1147022862 17:37552228-37552250 AGATATTTCTCATTATTAAAAGG + Intronic
1147680814 17:42243930-42243952 AGATGTAGCTTCTTCCCAAAGGG - Intronic
1149160195 17:53684285-53684307 ATATTTTTCTCATTGCCACATGG - Intergenic
1150873221 17:68938818-68938840 AGAAGATTCTCATTAACAAATGG - Intronic
1150955532 17:69855274-69855296 AGAGGTTTCACAATTCCAAATGG - Intergenic
1151348645 17:73518564-73518586 AGACGGTTCTCATTTCCAATAGG + Intronic
1153555415 18:6307704-6307726 AGACATTTTTCATTCTCAAAAGG - Intronic
1154471522 18:14707130-14707152 AAATCCTTCTCATTCCCCAAGGG - Intergenic
1154576175 18:16035874-16035896 AGATATTTCCCTTTCCAAAATGG - Intergenic
1154844086 18:19712176-19712198 AGATATTTCCCATTCCAACATGG - Intergenic
1155002164 18:21698126-21698148 ACATGTTTCTCTATCCCAAGAGG + Intronic
1156892087 18:42202838-42202860 AGATGTTTCCCACTGCCAAGAGG - Intergenic
1157738457 18:50071346-50071368 AGATGTTTCTATTTCCTCAAGGG + Intronic
1158158851 18:54457095-54457117 ATCTGTTTCTTATTCTCAAAGGG + Intergenic
1158409058 18:57188318-57188340 AGAAGTTTCTCACTACCTAATGG + Intergenic
1158978713 18:62737659-62737681 AGGTATTTGTCATTCCAAAAAGG + Intronic
1159269894 18:66135004-66135026 AGATGATTCTTATGCCAAAATGG - Intergenic
1159732837 18:72053252-72053274 AGTTGCTTCTCTTTCTCAAATGG - Intergenic
1164109267 19:22139525-22139547 AGAAGTTACTCATTTCAAAATGG + Intergenic
1164362467 19:27529627-27529649 AGATATTTCTTTTTCACAAAAGG - Intergenic
1165612634 19:37169665-37169687 ACATGTTGCTCATTCTCAACAGG + Intronic
925391139 2:3494903-3494925 AGTTGTGTCTAAATCCCAAAAGG - Intergenic
928669534 2:33586963-33586985 GCATGTTTCTCGTTGCCAAATGG - Intronic
929286500 2:40141049-40141071 AGATGTTCTTCTTTCCAAAATGG - Intronic
930233669 2:48868347-48868369 AGATGTTTTTAATTGCCTAAGGG - Intergenic
931035939 2:58242858-58242880 AGATGTTTCTCATTCCCTACAGG + Intergenic
931670536 2:64643227-64643249 AGTTGTTGCTGTTTCCCAAAAGG - Intronic
932981705 2:76676534-76676556 AGATATTTTTAATTCCAAAATGG - Intergenic
933831833 2:86217539-86217561 AGAGGTTTCTCATCCAGAAAGGG - Intronic
935834913 2:107039730-107039752 ATATTTTTCTCACTACCAAATGG + Intergenic
937569384 2:123337034-123337056 ACATTCTTCTCATTCCCACATGG + Intergenic
938338303 2:130518452-130518474 AGGTGTTTCTCACTCCCCACAGG + Intergenic
938351536 2:130602298-130602320 AGGTGTTTCTCACTCCCCACAGG - Intergenic
938524207 2:132110579-132110601 AGATATTTCTAATTCATAAATGG - Intergenic
940459929 2:153952096-153952118 AGATATTTCTGACTCCTAAATGG + Intronic
940831098 2:158466896-158466918 AGATATTACTGATTCACAAAAGG - Intronic
942304915 2:174597931-174597953 AAATGTTTCTCCTCCCCACAAGG + Intronic
942914046 2:181281094-181281116 TGCTGTTTCTCATTCCCATAGGG - Intergenic
946809653 2:223510089-223510111 AGATATTTCACATGGCCAAAAGG + Intergenic
947406353 2:229781552-229781574 TGATCTTCCACATTCCCAAAAGG + Intronic
948083901 2:235230134-235230156 AAATGTTCCTCATCTCCAAAGGG - Intergenic
1169051482 20:2582253-2582275 GGATGTGTCTGATTCCCATATGG - Intronic
1169052585 20:2593382-2593404 CATTGATTCTCATTCCCAAATGG - Intronic
1169058962 20:2647022-2647044 AGAATTTTCTCACTCACAAAAGG + Intergenic
1170101641 20:12707486-12707508 AGATTTTTCTCAAGCTCAAATGG - Intergenic
1171235641 20:23522183-23522205 AGTTGTTTCTGAATTCCAAAGGG + Intergenic
1174328232 20:49796705-49796727 AGATGTTTCTCATTGCAAAATGG + Intergenic
1174340855 20:49894141-49894163 AAATGTTTCTCTCTCCCTAAAGG - Intergenic
1176690108 21:9896347-9896369 AGGTGGTTCACATTTCCAAATGG - Intergenic
1179999133 21:44987227-44987249 AGGTGGTTCTCATTGCCAGACGG + Intergenic
1180437219 22:15319531-15319553 AGATATTTCTAATTCATAAATGG + Intergenic
1180520072 22:16189799-16189821 AGATATTTCTAATTCATAAATGG + Intergenic
1181322868 22:22022268-22022290 TGTAGTTTCTCACTCCCAAAAGG - Intergenic
1181691141 22:24561644-24561666 AGGATGTTCTCATTCCCAAAAGG - Intronic
1182711152 22:32324057-32324079 TGGTGCTTGTCATTCCCAAACGG - Intergenic
1183544807 22:38449770-38449792 AGATGATTCTCATTTACAGAAGG - Intronic
1184260630 22:43313612-43313634 AGATCTTGCTCAACCCCAAATGG - Intronic
950737788 3:15024672-15024694 AGATGTTCGTCAGTCCAAAAGGG + Intronic
951259034 3:20484367-20484389 ACATTTTTCTCATTGCCACATGG + Intergenic
953629069 3:44596763-44596785 AGATTTTTCTCAGTGACAAAAGG - Exonic
955580150 3:60410871-60410893 AGATCTTTCTCTTTCCTATATGG + Intronic
955875693 3:63488254-63488276 TATTGTTTCTCATTACCAAAGGG + Intronic
955985852 3:64573266-64573288 AGGTGATTCCCATTCCCAAGTGG + Intronic
956264069 3:67378046-67378068 GGGTCTTTCTCATTCCCATAAGG - Intronic
956412191 3:68991211-68991233 AGAAGTGCCTCCTTCCCAAATGG - Intronic
956538370 3:70305472-70305494 AGATAATTCTCATTTCTAAACGG - Intergenic
958849661 3:99308988-99309010 ACATTTTTCTCATTGCCACATGG - Intergenic
960060687 3:113317403-113317425 AGATGTGCCCCAGTCCCAAAGGG - Intronic
963476987 3:145819842-145819864 AGATGTTAATCATTCTCAAATGG + Intergenic
965123745 3:164596544-164596566 GGCTGTTTCACATTCCCAAGGGG + Intergenic
966554126 3:181239773-181239795 TGATGTTTCTCATTCTCAGTAGG - Intergenic
966574445 3:181483830-181483852 TGATGTTTCTCATGTCCAAATGG - Intergenic
966613989 3:181894916-181894938 AGCTGTTTGGCATTCCTAAAAGG - Intergenic
966907261 3:184536084-184536106 AAATGTTTCTCATTCACATGAGG + Intronic
969358064 4:6642794-6642816 AGATGGTTCTCACTGTCAAATGG + Intergenic
971574508 4:28256261-28256283 ACATTTTTCTCAGTGCCAAATGG + Intergenic
971937762 4:33174798-33174820 ATATGTTTCTCATTGACAATTGG - Intergenic
971959200 4:33463132-33463154 AGATGTTTGTGATTCCTAACAGG + Intergenic
973160620 4:47011509-47011531 ATATGTTTCTGTTTCCCAAATGG - Intronic
973195219 4:47431879-47431901 AAATGATTTTCCTTCCCAAATGG - Intergenic
974674229 4:65069918-65069940 AGTTATTTCTCATTCACCAAAGG - Intergenic
975696187 4:77015666-77015688 GGATGTTATGCATTCCCAAAGGG - Intronic
976454395 4:85229073-85229095 AGATGTGGCCCAGTCCCAAAGGG + Intergenic
976516611 4:85975262-85975284 AGATGTTTCTCATGCCAAGGTGG - Intronic
977017859 4:91715973-91715995 AGAAATTGCTCAATCCCAAAAGG + Intergenic
978938406 4:114407713-114407735 CCATGTTTCTCAATTCCAAATGG + Intergenic
980353522 4:131714277-131714299 AGGTGGTTCACATTTCCAAATGG - Intergenic
982626941 4:157779520-157779542 AAAGGTTTCTCCTTCCCACATGG + Intergenic
983382800 4:167019030-167019052 AGCTGTTTCCCTTTCCCAAGAGG + Intronic
983415957 4:167454765-167454787 AGATGTTGCTCATTCCCTAGAGG - Intergenic
983837150 4:172403335-172403357 AATTGTTTCTGATTCTCAAAGGG - Intronic
984459465 4:180015220-180015242 AGATTTTTCTCATTCCTTCAAGG + Intergenic
984666633 4:182436239-182436261 AGATGTTTCCCTTATCCAAACGG + Intronic
985317682 4:188675403-188675425 ACATTTTTCTCAGTCCCACATGG + Intergenic
987269930 5:16296663-16296685 ACATTTTTCTCATTGCCACAAGG - Intergenic
987909227 5:24120670-24120692 AGAAGATTTTCATTCCCCAAAGG - Intronic
988305722 5:29492103-29492125 ACATGTTTCTCACTCATAAATGG - Intergenic
989666053 5:43855284-43855306 AGATTTTTCTCATTTCCATCAGG - Intergenic
989807266 5:45624740-45624762 AGATGTTTCTCATTCCCAAATGG - Intronic
993018912 5:82567022-82567044 ACATGTTTCTAATTGCCACATGG + Intergenic
993100420 5:83532113-83532135 GGAGGTATCTCATTCCGAAATGG - Intronic
993858204 5:93101423-93101445 AGGTGTTTTTCTTCCCCAAAAGG - Intergenic
994032045 5:95154251-95154273 AGCTGTTTCTTATTCACAGAAGG + Intronic
995258055 5:110070398-110070420 ACATTTTTCTCATTGCCACATGG - Intergenic
998764571 5:145471376-145471398 AGATATTTCTTATACCAAAAGGG + Intergenic
1000539140 5:162518068-162518090 AGATAATTCTCTTTCCTAAAAGG - Intergenic
1003039843 6:2677667-2677689 AGATAGTTCTCCTTCCCCAACGG - Intronic
1003619156 6:7682555-7682577 AGATGTTTTTCAGACTCAAAAGG - Intergenic
1004967169 6:20866480-20866502 AGATGGCTCTTATGCCCAAATGG - Intronic
1005229516 6:23684316-23684338 AGACATTTCCCATTCCAAAAGGG + Intergenic
1005348533 6:24912370-24912392 AGCTTTTGCTCATTTCCAAATGG + Intronic
1005782119 6:29202915-29202937 AGATGTGTCTTAGTCCCATAGGG + Intergenic
1006040425 6:31248507-31248529 ACATTTTTCTCATTGCCACATGG + Intergenic
1006668851 6:35717134-35717156 AGCTTTTTCTCATTCCCACAGGG + Intronic
1007123186 6:39400568-39400590 AGATTTTTCTCTATCCCCAAAGG + Intronic
1008065893 6:47047723-47047745 AGATGTCTCTCTTTGCCTAAAGG - Intergenic
1008209230 6:48701450-48701472 TGACGTTTCTCATTGCCAGATGG + Intergenic
1008822123 6:55645747-55645769 AGATCTTTTTCATTACCAAATGG - Intergenic
1009333099 6:62450024-62450046 AAATGTATTTCATTACCAAATGG - Intergenic
1010734269 6:79425889-79425911 AGATGTTTATCATTAGCAAAAGG - Intergenic
1011180677 6:84616645-84616667 AGATATTTTTCATAGCCAAATGG + Intergenic
1011328143 6:86173430-86173452 GGCTGTTTCTCATGCCCAGAGGG + Intergenic
1013094221 6:106929685-106929707 AAATGTTTCTTTTTCTCAAATGG - Intergenic
1013991830 6:116263058-116263080 ACATTCTTCTCATTCCCACATGG - Intronic
1014043147 6:116852348-116852370 AGATTCTTCTCATTGCCACATGG + Intergenic
1015216792 6:130759580-130759602 AGAAATTTCTCATTCCAAAATGG + Intergenic
1016031780 6:139345136-139345158 TGAGGTTTCTCATTCCCCCATGG - Intergenic
1017352586 6:153459404-153459426 AGATGTGCCTCAGTCCCACAGGG + Intergenic
1021808085 7:24376553-24376575 AAATGATTATCATTCCAAAAAGG - Intergenic
1024514028 7:50228454-50228476 ACATGCTTCTCATTCACTAAAGG - Intergenic
1024665969 7:51547604-51547626 AGTGGTTTCTCATTTTCAAAGGG + Intergenic
1025214743 7:57046765-57046787 AGATCTTTCTCATTTACAACAGG - Intergenic
1025657210 7:63530045-63530067 AGATCTTTCTCATTTACAACAGG + Intergenic
1026048140 7:66921820-66921842 AGATGTGTTTCACTGCCAAACGG - Intronic
1027128814 7:75576102-75576124 AGATGTTTCTGGATGCCAAAGGG - Intronic
1027168861 7:75855671-75855693 AGATGATTCTAATTCCCAAAAGG - Intronic
1028957242 7:96707469-96707491 AAATGTTTCTCACTCTAAAATGG + Intronic
1028980798 7:96966128-96966150 AGATGTTCATCATTACTAAATGG - Intergenic
1030465518 7:109898380-109898402 AGATGTTTCTGATTATGAAAGGG - Intergenic
1031228872 7:119078594-119078616 AGTTCTTTCTCTTACCCAAATGG - Intergenic
1031539396 7:122975577-122975599 AAATGTCTCACATGCCCAAATGG + Intergenic
1031821271 7:126504977-126504999 AGAGGTTTTTCATTCCAAGAAGG + Intronic
1031868319 7:127064070-127064092 ACATTCTTCTCATTGCCAAATGG - Intronic
1035526765 8:319339-319361 ACATTTTTGTCATTCCCTAAGGG + Intergenic
1036427242 8:8655871-8655893 ACATTTTTCTCATTGCTAAAAGG - Intergenic
1036443529 8:8802494-8802516 AGGGGTTTCTCATTCACATATGG - Intronic
1036738940 8:11344761-11344783 AGATGTTTATCAATAACAAAGGG - Intergenic
1041124425 8:54621194-54621216 TGATGTTCCTCACTCCAAAAGGG - Exonic
1041158027 8:55007887-55007909 AGATGTTTCTTCTTCCTAACTGG + Intergenic
1041745079 8:61199757-61199779 ATGTCTTGCTCATTCCCAAAGGG + Intronic
1041758861 8:61342213-61342235 AGATGTTTCTCATCCTCTAAAGG - Intronic
1042349195 8:67759977-67759999 AGATGCTTCTCCTTCCCAGGTGG + Intergenic
1043422656 8:80114781-80114803 AGTAGTTTCTCATTCACAATAGG - Intronic
1043758006 8:84028810-84028832 AGATTTCTGTAATTCCCAAAAGG - Intergenic
1044042094 8:87383031-87383053 AGATTTTTTTTAATCCCAAAAGG - Intronic
1044098785 8:88102860-88102882 AGAAGAGTCCCATTCCCAAAAGG - Intronic
1045672972 8:104577274-104577296 ACATGTTTCTCATTGCCAGATGG + Intronic
1048918598 8:139207332-139207354 AAAGGCTTCTCATTCCCAAATGG - Intergenic
1050547069 9:6718061-6718083 AGATTTTTCTCATTTGCAATGGG - Intergenic
1051548695 9:18305310-18305332 AGATTTTTTTCATTCCCCAGTGG + Intergenic
1051559754 9:18427072-18427094 CCATGATTATCATTCCCAAATGG + Intergenic
1052670222 9:31547581-31547603 AGATGTTTTTCATTAGAAAAGGG + Intergenic
1052869252 9:33487219-33487241 AGATGTTTATCATTTGCAAAGGG + Intergenic
1053438652 9:38095342-38095364 AGAATTTACTCATTCCCAAGAGG - Intergenic
1053626836 9:39880892-39880914 AGGTGGTTCACATTTCCAAATGG - Intergenic
1053779154 9:41585128-41585150 AGGTGGTTCACATTTCCAAATGG + Intergenic
1054167113 9:61795369-61795391 AGGTGGTTCACATTTCCAAATGG + Intergenic
1054217051 9:62369811-62369833 AGGTGGTTCACATTTCCAAATGG + Intergenic
1054670434 9:67785529-67785551 AGGTGGTTCACATTTCCAAATGG - Intergenic
1055474110 9:76644337-76644359 AGGTGCTTCTCATTACAAAATGG - Intronic
1057689151 9:97267836-97267858 AGATGTTTATCATTTACAGAGGG - Intergenic
1057767607 9:97935828-97935850 TGATGTTTCCCACTCCCAACAGG + Intronic
1057895723 9:98907050-98907072 GCATTTTTCTCATTTCCAAAAGG + Intergenic
1058774662 9:108271850-108271872 AGACATTACTCATTCTCAAATGG + Intergenic
1058803203 9:108565120-108565142 AGATGATTCTCATTTGCCAATGG - Intergenic
1058933739 9:109748323-109748345 CCCAGTTTCTCATTCCCAAAAGG + Intronic
1059835882 9:118151836-118151858 TGATGTTTTTCACTCCCAGATGG - Intergenic
1059966551 9:119620412-119620434 AGTTGTTTATCATTAACAAATGG - Intergenic
1060150948 9:121287844-121287866 AGATTTTCATCATCCCCAAAAGG + Intronic
1061092955 9:128437016-128437038 AGATGGATCCCATTCCCTAAAGG + Exonic
1203453900 Un_GL000219v1:146559-146581 GGAATTTTCTCTTTCCCAAATGG + Intergenic
1187152319 X:16692720-16692742 AGTCCTTTCTCATTCTCAAACGG - Intronic
1187984496 X:24795789-24795811 AGGTGTTTGTCTTTCCGAAAAGG + Intronic
1190409976 X:50127032-50127054 AGATTTTTGTCATTTCAAAAAGG + Intergenic
1191780876 X:64863878-64863900 TGATCTTTCTAATTTCCAAAAGG + Intergenic
1192524137 X:71827079-71827101 AGGTGTTTCATCTTCCCAAACGG - Intergenic
1193251738 X:79298938-79298960 AGATATGTCTCAGTCCCAAGAGG - Intergenic
1194007862 X:88519435-88519457 ACATTTTTCTCATTGCCACATGG - Intergenic
1194433137 X:93836669-93836691 AAATGTATCCCATTCCAAAAGGG + Intergenic
1194822237 X:98523859-98523881 AGATTTTTCTGATTCGCAATTGG - Intergenic
1197085926 X:122475265-122475287 AAATGCTTATCATGCCCAAAGGG + Intergenic
1198715175 X:139551010-139551032 TGATATTTCTCATTGGCAAATGG - Intronic
1199063158 X:143383488-143383510 ATATTTTTCTCATTGCCACATGG - Intergenic
1199258205 X:145741828-145741850 ACATCTTTCTGATTCCAAAAAGG + Intergenic
1200293363 X:154892872-154892894 AGATTTTTCTGAATTCCAAAAGG - Intronic