ID: 989807274

View in Genome Browser
Species Human (GRCh38)
Location 5:45624779-45624801
Sequence TTGTGTTTATGGAGGCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989807266_989807274 16 Left 989807266 5:45624740-45624762 CCATTTGGGAATGAGAAACATCT 0: 1
1: 0
2: 4
3: 21
4: 285
Right 989807274 5:45624779-45624801 TTGTGTTTATGGAGGCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989807274 Original CRISPR TTGTGTTTATGGAGGCAAGC AGG Intronic
No off target data available for this crispr