ID: 989807666

View in Genome Browser
Species Human (GRCh38)
Location 5:45630243-45630265
Sequence ATTTAAGCAGAGAGGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 574
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 543}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989807660_989807666 19 Left 989807660 5:45630201-45630223 CCTGCCTCTTTTCCAAAACTAGT 0: 1
1: 0
2: 0
3: 29
4: 279
Right 989807666 5:45630243-45630265 ATTTAAGCAGAGAGGGAGCAAGG 0: 1
1: 0
2: 2
3: 28
4: 543
989807661_989807666 15 Left 989807661 5:45630205-45630227 CCTCTTTTCCAAAACTAGTATAT 0: 1
1: 0
2: 1
3: 21
4: 255
Right 989807666 5:45630243-45630265 ATTTAAGCAGAGAGGGAGCAAGG 0: 1
1: 0
2: 2
3: 28
4: 543
989807662_989807666 7 Left 989807662 5:45630213-45630235 CCAAAACTAGTATATACCAGTTT 0: 1
1: 0
2: 2
3: 17
4: 191
Right 989807666 5:45630243-45630265 ATTTAAGCAGAGAGGGAGCAAGG 0: 1
1: 0
2: 2
3: 28
4: 543
989807663_989807666 -9 Left 989807663 5:45630229-45630251 CCAGTTTCAGTCATATTTAAGCA 0: 1
1: 0
2: 0
3: 15
4: 192
Right 989807666 5:45630243-45630265 ATTTAAGCAGAGAGGGAGCAAGG 0: 1
1: 0
2: 2
3: 28
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989807666 Original CRISPR ATTTAAGCAGAGAGGGAGCA AGG Intronic
900779720 1:4610215-4610237 ATTTGAGCTGTGAGGGAGCCTGG + Intergenic
901037664 1:6346056-6346078 CTGGAAGCAGAGAGGGAGCCAGG + Intronic
901292662 1:8136348-8136370 ATTTCGGCAGAGATGGAGCTTGG - Intergenic
901917388 1:12510261-12510283 GATTAAGCAGATAGGGAGAAGGG + Exonic
902710423 1:18235742-18235764 GTTTAAGCAGAGAAGTAACAGGG + Intronic
903421497 1:23220528-23220550 ATCTAAGCAAAGAAAGAGCAAGG + Intergenic
904216832 1:28927674-28927696 ATTTAAGAGGAGAAGGAGAAAGG - Intronic
905271349 1:36789719-36789741 ATTGAAGGAGTGAGGGAGCTGGG - Intergenic
905471532 1:38195888-38195910 ATTTAATCAGAGTGGGGACAAGG - Intergenic
906418109 1:45638647-45638669 ATTTATTCAGAGGGTGAGCACGG + Intronic
907777432 1:57531658-57531680 AATAAAGCAGAGAGGGAGGGAGG + Intronic
908082320 1:60594323-60594345 CTTTAAGCAGTGAGGAACCATGG + Intergenic
908300388 1:62756509-62756531 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
908390050 1:63675923-63675945 ATTTCAGGAGAGAGGGAGAAGGG - Intergenic
909016832 1:70389042-70389064 ATTAAAGCAGAGAGGGAGGAAGG - Intergenic
909379487 1:74981946-74981968 ATTTAGGTAGAAAGGGAGGAAGG + Intergenic
910397471 1:86806912-86806934 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
910476909 1:87617147-87617169 ATTTAAGCAGAGAGAAAGCAGGG + Intergenic
910746532 1:90580792-90580814 GTGAAAGCAAAGAGGGAGCAAGG - Intergenic
911129800 1:94376571-94376593 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
911605967 1:99905524-99905546 ATTTCAGCAAAGAGGGAAGATGG - Intronic
911751386 1:101501120-101501142 TTTAAATCAGAGAGGGAGGAGGG - Intergenic
911845648 1:102747854-102747876 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
912021271 1:105111269-105111291 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
912338830 1:108889788-108889810 TATTAAGCAGAGAGGTTGCACGG - Intronic
912365607 1:109131251-109131273 AGGTAATCAGAGAGAGAGCAAGG + Intronic
912596401 1:110881228-110881250 AGGTGAGTAGAGAGGGAGCAGGG - Intronic
913401715 1:118441841-118441863 GTTGAAGCAGAGAGGAAGAAAGG + Intergenic
913655820 1:120958537-120958559 ATTTAAAAAGAGGGAGAGCAGGG - Intergenic
914520372 1:148409764-148409786 ATTTAAAAAGAGGGAGAGCAGGG - Intergenic
914850909 1:151313412-151313434 ATGTAAGGAAAGAGGGACCAAGG + Intronic
915260536 1:154673736-154673758 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
916083601 1:161252376-161252398 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
916114410 1:161474813-161474835 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
916939500 1:169664257-169664279 TTTAAATCAGAGAGGGAGAAGGG - Intronic
917086100 1:171307099-171307121 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
917184685 1:172340134-172340156 ATTTAAGGAGAGAGGTGGCAAGG + Intronic
917227548 1:172800643-172800665 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
917279855 1:173370097-173370119 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
917281132 1:173378958-173378980 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
917281183 1:173379356-173379378 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
917445826 1:175105269-175105291 TTTAAATCAGAGAGGGAGAAGGG + Intronic
917491031 1:175498660-175498682 AGTTAAGCAGAGAAGGAATATGG + Intronic
917676251 1:177321862-177321884 TTTAAATCAGAGAGGGAGCAGGG - Intergenic
918750204 1:188261481-188261503 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
918989043 1:191674236-191674258 ATTAGAGCAGGGAGGGAGGAAGG - Intergenic
919116826 1:193290451-193290473 ATGAAATCAGAGAGGGAGTAGGG + Intergenic
922550685 1:226491932-226491954 TTTTAAGCAGATAGAGAGAAAGG - Intergenic
923060173 1:230464860-230464882 ATTTAAGGAGAAGGGGAGAATGG - Intergenic
924011009 1:239665336-239665358 ATTCAAGATGAGAGGGACCAAGG - Intronic
1063321726 10:5057989-5058011 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1063646821 10:7893397-7893419 AGTTAAACAGAGAAGAAGCAGGG + Intronic
1063859110 10:10289472-10289494 TTTAAATCAGAGAGGGAGAAAGG + Intergenic
1064603591 10:17016598-17016620 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1065082387 10:22141043-22141065 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1065934303 10:30507142-30507164 ATTAAAGCAGTGAGGCATCATGG - Intergenic
1066614597 10:37282384-37282406 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1066995468 10:42559185-42559207 ATTTGATCAGTGAGGGAGGAGGG - Intergenic
1067416261 10:46105844-46105866 AATTAATCAATGAGGGAGCAGGG + Intergenic
1067436405 10:46282337-46282359 AATTAATCAATGAGGGAGCAGGG + Intergenic
1068248146 10:54400024-54400046 AATAAGGCAGAGAGAGAGCAAGG + Intronic
1068404975 10:56575976-56575998 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1068931013 10:62590232-62590254 ATTTCATCAATGAGGGAGCATGG + Intronic
1069365110 10:67688188-67688210 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1070745760 10:78932803-78932825 ATGGAAGCAGAGAGAGATCAGGG + Intergenic
1071834835 10:89408611-89408633 TTTAAATCAGAGAGGGAGCAGGG - Intronic
1071892650 10:90028436-90028458 ACTCAGGCACAGAGGGAGCAGGG - Intergenic
1072298927 10:94040332-94040354 ATTTAGGCAGAAAGGGAGGAGGG - Intronic
1072904178 10:99435882-99435904 ATTTAAGGAGAAACGGGGCAAGG - Intergenic
1072945166 10:99803461-99803483 ATGGAAGGAGAGAGGGAGGAAGG - Intronic
1073225977 10:101919389-101919411 AGCCAAGCAGAGAGGGAGCTGGG - Intronic
1073556087 10:104453142-104453164 ATTTAAGGTGAGAGAGGGCAGGG + Intronic
1073723903 10:106207730-106207752 TTTTAAGCACAGAGTGACCAAGG - Intergenic
1073880094 10:107971153-107971175 ATCAAAGCAGAGAGAGACCATGG + Intergenic
1073970730 10:109043516-109043538 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1074163655 10:110856076-110856098 AAAAAAGCAGAGAGAGAGCAAGG - Intergenic
1074613018 10:115039293-115039315 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1074742671 10:116500198-116500220 TTTAAAACAGAGAGGGAGAAGGG + Intergenic
1077268537 11:1664529-1664551 ATTTGACCAGAGAGGAAGGAAGG + Intergenic
1077272342 11:1687089-1687111 ATTTGACCAGAGAGGAAGGAAGG - Intergenic
1077424848 11:2470423-2470445 ATTGGAGGAAAGAGGGAGCATGG + Intronic
1077953448 11:6987854-6987876 ATTTCAGCATGGAGGGAGGAAGG + Intergenic
1078011337 11:7575385-7575407 ATGTAAGCTGGGAGTGAGCAAGG + Intronic
1078329847 11:10410160-10410182 ATTTAAGGAAATAGGGAGCCTGG + Intronic
1078332412 11:10436146-10436168 ATTGAAAGACAGAGGGAGCAGGG + Intronic
1079203264 11:18393318-18393340 ATTAAAGAAGAGATGGAGGAGGG + Intergenic
1079327537 11:19507053-19507075 ATTTAGGCAGAGAGGTTGCTGGG - Intronic
1079427544 11:20357780-20357802 ATTGAAGCAGAGGAGGAGTATGG - Intergenic
1079731239 11:23939342-23939364 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1080297062 11:30742356-30742378 ATTTTAGCAGAGAAGAAGGAAGG - Intergenic
1080582723 11:33657141-33657163 AAGCAAGCAGAGAGGGAGGAAGG + Intronic
1081033412 11:38113728-38113750 TTTGAATCAGAGAGGGAGAAGGG - Intergenic
1081145977 11:39562915-39562937 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1081428095 11:42947308-42947330 AGCTAAGCAGAGATGGAGCTGGG - Intergenic
1082906151 11:58310447-58310469 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1083412778 11:62505545-62505567 ATTTATGGAGACAGGGAGCGGGG + Intronic
1083851840 11:65372527-65372549 ATAGAACCAGAGAGGGAGAATGG + Intergenic
1084210989 11:67622268-67622290 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1085029232 11:73259583-73259605 ATTTAAGCAGGGTGGGACCTGGG - Intergenic
1085421628 11:76366892-76366914 ATTTAAGCACCGAGAGGGCATGG - Intronic
1086317374 11:85608731-85608753 TTTAAATCAGAGAGGGAGAAAGG - Intronic
1087074985 11:94120418-94120440 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1087270953 11:96111104-96111126 ATTGATGCAGAGATGGATCAAGG - Intronic
1087459012 11:98422759-98422781 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1087683346 11:101238426-101238448 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1087777482 11:102269465-102269487 GTTGAAGCAGAGAGGAAACATGG + Intergenic
1088492527 11:110401620-110401642 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1088834832 11:113568754-113568776 GATTAAGCAGAGAAGGAACACGG + Intergenic
1088837423 11:113589666-113589688 AGGAAAGCAGGGAGGGAGCAAGG + Intergenic
1089489287 11:118871798-118871820 CTTTAAGCAGAGGGGGTGGAGGG + Intergenic
1089850141 11:121488498-121488520 ATTTAATCAGAGAGAGAGCCAGG + Intronic
1091633488 12:2179898-2179920 TTTGAAGCAGAGAAAGAGCATGG - Intronic
1092472285 12:8790506-8790528 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1092839171 12:12522484-12522506 ATATAAGCAGAGATGGACCAGGG - Intronic
1092979709 12:13782312-13782334 ATATAAAGAGAGAGGGAGCGGGG - Intronic
1093345231 12:18033519-18033541 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1093580588 12:20781053-20781075 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1094338119 12:29383520-29383542 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1095154012 12:38830894-38830916 CTAGAAGCAGAGAGGCAGCATGG - Intronic
1095398404 12:41787431-41787453 TTATAAGCAGAGAAGTAGCAGGG - Intergenic
1096169852 12:49459130-49459152 ATTTAAGCAGAGAAGGAGATGGG + Intronic
1097391205 12:59016112-59016134 ATTAAAACAGAGAGGCAGTAAGG - Intergenic
1097428290 12:59473102-59473124 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1098466371 12:70791050-70791072 ATAAAAGCAGAGTGGAAGCAGGG - Intronic
1098518605 12:71409138-71409160 ATTTAAGCCGAGTGAGAGCATGG + Intronic
1099168273 12:79334336-79334358 ATTTAATGAAAGAGGGAGAAAGG + Intronic
1099376237 12:81898669-81898691 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1099414753 12:82372223-82372245 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1099464046 12:82960619-82960641 ACTAAAGCAGAGAGGGAGGGAGG + Intronic
1100209784 12:92388836-92388858 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1100390553 12:94142927-94142949 AGATCAGCAGAGAGGGAGCTGGG + Intergenic
1101132902 12:101707624-101707646 ATTAAAGCACAGAGAGGGCAAGG - Intronic
1101320048 12:103665592-103665614 ACCAAAGCAGAGAGGGAGCAGGG + Intronic
1101525437 12:105524209-105524231 CTTCAAGCAGAGAAGCAGCATGG + Intergenic
1101704865 12:107212085-107212107 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1101779650 12:107823954-107823976 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1102011068 12:109618618-109618640 TGGAAAGCAGAGAGGGAGCAGGG + Intergenic
1102414688 12:112750464-112750486 ATCTAAGGAGTGAGGGAGCTGGG + Intronic
1102663416 12:114549195-114549217 TTTTTAGCAGAGAGGGGACATGG + Intergenic
1102775246 12:115512995-115513017 ATCAAAGCTGAGAGAGAGCATGG - Intergenic
1103172209 12:118831221-118831243 ATTTAGGGAGAAAGGGAGTAGGG - Intergenic
1103385528 12:120529310-120529332 ATTTGAGAAGAGAGAGAGGAAGG - Intronic
1104306174 12:127612500-127612522 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1106420315 13:29580369-29580391 AGAAAAGCAGAGAGGAAGCACGG - Intronic
1108506107 13:51113828-51113850 ATCTAAGCAGGGAGAGAGAAGGG + Intergenic
1108743055 13:53358581-53358603 ATTCAAGCAGCCAGGGACCATGG + Intergenic
1108848590 13:54702476-54702498 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1109246585 13:59961660-59961682 TTTTAATCAGAGAAGCAGCATGG + Intronic
1109442705 13:62395691-62395713 AATTGAACAGAGAGGGATCATGG - Intergenic
1109501018 13:63236114-63236136 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
1109932047 13:69228749-69228771 ATTTAAGAAGAGGGGAAGGAGGG - Intergenic
1110039230 13:70731063-70731085 GTTTTAACAGAGTGGGAGCAAGG - Intergenic
1111372520 13:87335751-87335773 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1111795577 13:92915107-92915129 GTTAATGCATAGAGGGAGCAGGG - Intergenic
1111823520 13:93242401-93242423 TTTTGTGTAGAGAGGGAGCAGGG + Intronic
1112381669 13:98896773-98896795 AATGAGGCAAAGAGGGAGCAAGG - Intronic
1112519108 13:100080511-100080533 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1112538359 13:100283028-100283050 TTTAAATCAGAGAGGGAGAAGGG - Intronic
1112754886 13:102621469-102621491 AACTAAGCAGAGAGGTAGAAAGG + Intronic
1113254758 13:108495391-108495413 ATTGTAGCAGAGAGAGAGGAGGG + Intergenic
1113266146 13:108620403-108620425 ACTGAAGAAGAGAGGAAGCAGGG + Intronic
1113421101 13:110172029-110172051 ACTTCAGCTGAGAAGGAGCAGGG - Intronic
1113551516 13:111196536-111196558 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1113554813 13:111224258-111224280 AGTTAAGGAGAGAAGCAGCAAGG + Intronic
1115093362 14:29605335-29605357 ACTTAAGCAGAGAGAGAAAAAGG - Intronic
1115285470 14:31709703-31709725 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1115756418 14:36530795-36530817 ATTTAGGCAGATGGGAAGCAGGG - Intergenic
1117184692 14:53227794-53227816 ATCCAATCAGGGAGGGAGCATGG + Intergenic
1118930135 14:70234070-70234092 CTTTAAGAAGATAGGGATCAGGG + Intergenic
1119637178 14:76283370-76283392 TTTTAAGGAGGGAGGGAGGAGGG + Intergenic
1120198779 14:81515229-81515251 TTTAAATCAGAGAGGGAGGAGGG - Intronic
1120219187 14:81713460-81713482 AAGTGAGCAGAGAGGGAGAAAGG + Intergenic
1120444931 14:84582642-84582664 AAGGAAGGAGAGAGGGAGCAAGG + Intergenic
1121028374 14:90634473-90634495 ATATAAGAAGAGAGGGAGGCCGG + Intronic
1121875854 14:97451775-97451797 ATTCAAGAAGAGAGAAAGCATGG - Intergenic
1122123708 14:99568086-99568108 CTTTAGGCAGAGAGGCAGGAGGG + Intronic
1122158665 14:99767202-99767224 ACTATAGCCGAGAGGGAGCATGG + Intronic
1122327551 14:100891559-100891581 AGTCAAGCATAGAGGGGGCAGGG - Intergenic
1124103782 15:26718812-26718834 ACTTCAGCAGTGTGGGAGCACGG - Intronic
1124653981 15:31493970-31493992 CTCAAAGCAGAGAGGGAGGAGGG + Intronic
1124861971 15:33450568-33450590 ATTCAAGAACAGAGGGTGCAAGG - Intronic
1125774539 15:42199780-42199802 ATTGAAGGTTAGAGGGAGCACGG - Intronic
1126072085 15:44874182-44874204 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1126086105 15:45012484-45012506 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1126384576 15:48080834-48080856 CTTTAAGCAGAGGGTAAGCATGG + Intergenic
1129790256 15:78336422-78336444 ATTTAAGCAGAGATGAGCCATGG - Intergenic
1130568427 15:85019053-85019075 ATGGAAGCAGGGAGGCAGCAAGG - Intronic
1131411190 15:92209532-92209554 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1131771832 15:95746196-95746218 GTTTGAGTAGAGAGGTAGCATGG - Intergenic
1132107613 15:99074611-99074633 ATCTAAGCAGTGAGGGAGCTGGG + Intergenic
1133857229 16:9560905-9560927 ATTTGAGCAGAGTGGGGTCAAGG + Intergenic
1134092112 16:11397005-11397027 AATGAAGCAGAGAGGGGCCAGGG - Intronic
1134825736 16:17282631-17282653 CTTTAAGGAGAGAAGGAGCTGGG + Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135339690 16:21635218-21635240 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1138245195 16:55462288-55462310 ATTTGAAGAGAAAGGGAGCAGGG + Intronic
1138293389 16:55867121-55867143 TTCCCAGCAGAGAGGGAGCACGG - Intronic
1138343482 16:56306128-56306150 CTTTCAACAAAGAGGGAGCAGGG - Intronic
1138344462 16:56311622-56311644 ATGTCAGCAGGGAGGGAGGAGGG - Intronic
1139449166 16:67016443-67016465 CTGTAAGCTGGGAGGGAGCATGG + Intergenic
1140379292 16:74471784-74471806 TTTTAAGAAGAGATGGAACAGGG - Intronic
1140512945 16:75521235-75521257 ATTAAAGTGGAGAGGGATCAGGG - Intergenic
1140935030 16:79662438-79662460 AATTCAGCAGAGAAGTAGCATGG - Intergenic
1141394609 16:83693493-83693515 ATTTAAGCAGTGAGGTACCCGGG - Intronic
1142027454 16:87822185-87822207 TTTGACGGAGAGAGGGAGCAGGG - Intergenic
1142593605 17:1018970-1018992 GTTTCAGCAGAGAGGGTGCTGGG - Intronic
1145043725 17:19595956-19595978 GTTTAAGCAGAGAAGGTGCCAGG - Intergenic
1145967707 17:28932064-28932086 CTTGAAGCAGAGAGGAAACATGG - Intronic
1146310492 17:31764706-31764728 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1147032195 17:37647880-37647902 TTTTAAGCAGAGAAGCAACATGG - Intergenic
1147403231 17:40193269-40193291 AGTAAAGCAGAGTGGGAGAATGG + Intronic
1148293212 17:46475253-46475275 CTGCAAGCAGAGAGGGAGCATGG + Intergenic
1148315397 17:46692956-46692978 CTGCAAGCAGAGAGGGAGCATGG + Exonic
1148666037 17:49375687-49375709 ATGCCAGCAGAGAGGAAGCAGGG + Intronic
1148690989 17:49526839-49526861 ATCTAAGCAGAGCTGGGGCAGGG - Intergenic
1149007478 17:51821000-51821022 ATTAAGGGAGGGAGGGAGCATGG - Intronic
1149193971 17:54097420-54097442 TTTTAAGCAAAGAGAGGGCAGGG - Intergenic
1149572862 17:57685941-57685963 GCCTAAGGAGAGAGGGAGCAGGG + Intergenic
1149999189 17:61422291-61422313 ATTTAAAGAGAGAGTGAGCCAGG + Intergenic
1151020493 17:70611446-70611468 ATTTAAGCAGTTAGCGAGAAGGG - Intergenic
1152591564 17:81215923-81215945 ATGTAAGGAAAGCGGGAGCAGGG + Intronic
1153438034 18:5087681-5087703 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
1153521400 18:5957789-5957811 TTTTCAGTAGAGATGGAGCAGGG - Intronic
1153627500 18:7035710-7035732 ATTTAAAAAGAAAGGGAGCTGGG - Intronic
1153635883 18:7113186-7113208 ACTTCAGCAGAGAGAGAGCTGGG + Intronic
1153982989 18:10328448-10328470 ATATAAGATGAGATGGAGCAGGG + Intergenic
1153998375 18:10462430-10462452 AGGAAAGGAGAGAGGGAGCAAGG - Intronic
1155137749 18:23013284-23013306 AGTTTGGCAGAGAGGGAGCTGGG + Intronic
1155182368 18:23358890-23358912 TCCTAAGCAGAGAGGGTGCACGG + Intronic
1156276123 18:35584458-35584480 AGTTAGGCAAAGAGGGACCAAGG + Intronic
1156336113 18:36173016-36173038 ATTTAAGAAGATAGGGAGTTTGG - Intronic
1157471964 18:47996177-47996199 ATTGAAGCAGAGAGGGTGGGAGG + Intergenic
1157743107 18:50110571-50110593 ATTTAAGAGGAGAGGCAGGAGGG - Intronic
1157857915 18:51118265-51118287 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1158138639 18:54232960-54232982 ATATAAAGAGAGAGAGAGCAGGG + Intergenic
1158865709 18:61636107-61636129 ATGAAAGAAGAGAAGGAGCAAGG + Intergenic
1159402985 18:67961155-67961177 ATTTATTCAGAGAGGAAGAAAGG + Intergenic
1160615209 18:80121168-80121190 AAGGAAGCAGAGAGGGAGAAAGG - Intronic
1162237492 19:9320747-9320769 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1163511015 19:17734990-17735012 ATTTCTGCAGAGAGGGGTCAGGG - Intergenic
1165401167 19:35601260-35601282 GTTTTAGGAGAGAGGGAACAGGG - Intergenic
1166496488 19:43306548-43306570 AGAGGAGCAGAGAGGGAGCAGGG + Intergenic
1168677161 19:58286887-58286909 GATGAAGCAGAGAGGGAGGAAGG - Intronic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
925876688 2:8317326-8317348 TTTTCAGGAGAGAGGGAACATGG + Intergenic
925949922 2:8900479-8900501 TTTAAATCAGAGAGGGAGAAGGG + Intronic
926952493 2:18258562-18258584 ATTTAAGAAGTGTGGGACCAGGG + Intronic
928706391 2:33954199-33954221 AGTTATGGAGTGAGGGAGCAGGG - Intergenic
928718925 2:34096832-34096854 ATTGAAGAAGAGAGGCTGCATGG + Intergenic
929988270 2:46759579-46759601 ATGTTAGCAGACAGGGAGCTTGG + Exonic
930038500 2:47102805-47102827 TTTAAATCAGAGAGGGAGAAGGG - Intronic
930963602 2:57291581-57291603 ATTTAGGCAGACAGAGAGAAAGG - Intergenic
931252402 2:60544971-60544993 ATTTTAGCAGGGAGGCAGCTAGG - Intronic
931540464 2:63324469-63324491 TTTAAATCAGAGAGGGAGAAGGG - Intronic
932274614 2:70442751-70442773 ATTGGAGCAGGGAGGGAGCGAGG + Intergenic
932400637 2:71478887-71478909 AGGGAAGCAGAGAGGGATCAAGG - Intronic
932997471 2:76872896-76872918 ATTTGGCAAGAGAGGGAGCAAGG - Intronic
933172397 2:79138452-79138474 ATTTAAGCCGGGGTGGAGCAAGG + Intergenic
933342128 2:81037482-81037504 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
933825848 2:86160151-86160173 AGTGAACCAGAGAGGTAGCATGG + Intronic
934041913 2:88134190-88134212 TTTAAAGCAGAGAGGTTGCAGGG - Intergenic
934867097 2:97823324-97823346 TTTAAATCAGAGAGGGAGAAGGG - Intronic
935063021 2:99624190-99624212 ATTCAAGCAGATAGGTAGCTGGG - Intronic
937057979 2:118955145-118955167 AGTTAATCAGGGAGGGACCAGGG + Intronic
938806217 2:134809179-134809201 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
939851828 2:147313609-147313631 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
939965469 2:148606254-148606276 AGTGAAGCAGAGAGGAAGGAAGG + Intergenic
940235233 2:151504514-151504536 GTATAAGCAGAGAGTGAGAAGGG + Intronic
941164959 2:162074374-162074396 TTTTTAGCTAAGAGGGAGCAGGG - Exonic
941166429 2:162087829-162087851 ATTTAAGGAAAGAAGTAGCAAGG + Intergenic
941243387 2:163068982-163069004 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
941953093 2:171176795-171176817 GGTGAAGCAGAGAGTGAGCAAGG - Intronic
942068925 2:172297839-172297861 AGGTAAGCAGAGGGGGAGGAGGG - Intergenic
942206997 2:173629139-173629161 GTTTAAGCAGAGAAGAATCATGG + Intergenic
942337980 2:174911565-174911587 ATTTAGGCTGAGATGGGGCATGG + Intronic
942802703 2:179893740-179893762 ATTTATGCAGAGAAAGAGAAAGG - Intergenic
943103098 2:183510718-183510740 TTTAAAACAGAGAGGGAGAAAGG + Intergenic
943133723 2:183887664-183887686 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
943340173 2:186671300-186671322 ATGCAAGCAGAGAGGCAGGAAGG - Intronic
944535546 2:200705920-200705942 ATCTGAGAAGAAAGGGAGCAAGG - Intergenic
944728972 2:202499139-202499161 TTTAAATCAGAGAGGGAGAAGGG - Intronic
946169021 2:217883170-217883192 ATTTAAGAAGACAGGAAGTAGGG - Intronic
946207386 2:218119710-218119732 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
946348326 2:219129497-219129519 GATTAATCAGAGAGGGAGGAAGG - Intronic
946601134 2:221361539-221361561 ACCTCAGCAGAGAGGGAGCAGGG - Intergenic
947709936 2:232307287-232307309 CTTTAGGAAGGGAGGGAGCATGG + Intronic
948836827 2:240629904-240629926 AGGTCAGCAGAGAGTGAGCAGGG - Intronic
1168895447 20:1320534-1320556 ATTCAAACAGAAAGGCAGCAGGG + Intronic
1168896605 20:1328155-1328177 AGTTGTGCAGAGAGGGAGTAAGG + Intronic
1169220288 20:3818647-3818669 ATTACAGCAGAGAGCTAGCAAGG - Intergenic
1169297202 20:4410478-4410500 ACTTAAGCAGCGAGGAAGCTGGG - Intergenic
1169978524 20:11357605-11357627 AACTGAACAGAGAGGGAGCAGGG + Intergenic
1171261480 20:23738152-23738174 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
1172340623 20:34154656-34154678 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1173338948 20:42136923-42136945 ACCTAAGCAGAGAGGGAGCTGGG + Intronic
1173801777 20:45898671-45898693 CTTTAAGCAGAGAAGGGGCCAGG - Exonic
1174651976 20:52134268-52134290 AATTTAGCAGAGAGGCAGCCTGG - Intronic
1174978138 20:55358257-55358279 TCTTAAGCAGGGAGAGAGCAGGG - Intergenic
1175463510 20:59172976-59172998 AGTTAAGTCTAGAGGGAGCAGGG + Intergenic
1175717076 20:61262313-61262335 CTCTAAGCTGAGAGAGAGCAAGG + Intronic
1177135037 21:17299014-17299036 TTTAAATCAGAGAGGGAGGAGGG - Intergenic
1177725458 21:24961061-24961083 ATACAAGCAGAGAGGGAGCTAGG - Intergenic
1178237219 21:30856899-30856921 ATTAAAGCAGGGTGGGAGGAGGG + Intergenic
1178599492 21:33983801-33983823 ATGTAAGAGGAGAGGGAACAGGG - Intergenic
1179126461 21:38595385-38595407 AATTAAGCAGAGAAGGTGCAGGG + Intronic
1180116193 21:45706794-45706816 ACTGAAGCAGAGAGAGAACAGGG - Intronic
1181042951 22:20201465-20201487 GTTTAGGCAGAAAGGGAGGAAGG - Intergenic
1181116119 22:20633379-20633401 AGTTGGGCAGAGAGGGAGGAGGG - Intergenic
1181507961 22:23374401-23374423 TTCCCAGCAGAGAGGGAGCACGG - Intergenic
1181634648 22:24168989-24169011 TATTAAGCAGGGAGGAAGCAAGG + Intronic
1181650290 22:24255435-24255457 CTTTCAGCAGAAAGGGAGTAAGG + Intergenic
1181841913 22:25670626-25670648 ATTCAGGGAGAGAGGGAGGAAGG - Intronic
950191716 3:10981219-10981241 ACTCAAGGAGAGAGGGAGCTGGG - Intergenic
950227697 3:11249429-11249451 ATTTAGGAGGAGAGGGAGAAGGG + Intronic
950659814 3:14460349-14460371 AGTCAAGCAGAGAAGGAGAATGG + Intronic
951020460 3:17776694-17776716 TTTAAATCAGAGAGGGAGAAGGG - Intronic
951239446 3:20271908-20271930 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
952022742 3:29042259-29042281 ATGTCAGCAAAGATGGAGCAGGG - Intergenic
952452998 3:33448870-33448892 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
952555078 3:34522078-34522100 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
952940981 3:38444223-38444245 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
953622973 3:44548684-44548706 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
954586951 3:51744556-51744578 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
954598898 3:51852392-51852414 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
955656375 3:61249436-61249458 ATCTAAGTACAGAGGCAGCATGG + Intronic
955960904 3:64340465-64340487 ATTTAAGAAGAGATGGCGGATGG - Intronic
956173532 3:66452279-66452301 ATTTTAGCAGGAAGGGAGCTTGG - Intronic
956842991 3:73157275-73157297 TTTAAATCAGAGAGGGAGAAAGG + Intergenic
960270116 3:115664553-115664575 ATTTAAGCAGTGAATGAGCCAGG + Intronic
961261632 3:125606592-125606614 TTTAAAGCAGAGAGGGAGAAAGG - Intergenic
961330474 3:126135299-126135321 ATTTCAGCAGAGTGGGCTCAGGG - Intronic
961414578 3:126748037-126748059 TTTTAAGAGGAGAGGAAGCAAGG - Intronic
962954180 3:140249001-140249023 ATTTAAAGAGAGATGCAGCATGG + Intronic
963696721 3:148573064-148573086 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
963939321 3:151084768-151084790 ATTTAAGCAAAGGGGGAAGAAGG - Intergenic
964064465 3:152562047-152562069 CTTAAATCAGAGAGGGAGAAGGG - Intergenic
964680417 3:159331824-159331846 CTTTAAGCAGAGAATGAACATGG - Intronic
964972207 3:162576752-162576774 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
965062719 3:163803815-163803837 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
966173429 3:177109656-177109678 ATTTAAACTGTGAGAGAGCAGGG - Intronic
966444213 3:179982809-179982831 TTTTAAGGAGAGATGAAGCAAGG + Intronic
966629561 3:182057365-182057387 ATTTAAGCAGAGAGGGCATGTGG + Intergenic
966761851 3:183426167-183426189 ATAGAAGGAGGGAGGGAGCAAGG + Intronic
966826178 3:183966873-183966895 AATGAAACAGAGGGGGAGCAGGG - Intronic
967287122 3:187883037-187883059 CATTAAGCAGAGTGGAAGCATGG - Intergenic
967625733 3:191681634-191681656 AGTTATCCAGAGAGTGAGCAAGG - Intergenic
968340020 3:197947758-197947780 ATTCTGGCAGAGAAGGAGCAGGG - Intronic
970690539 4:18614916-18614938 ATTTAAGGAGGGAGGGAGGGAGG - Intergenic
971065095 4:23022384-23022406 ATTAAAAAAGAGAGAGAGCAGGG - Intergenic
971281240 4:25244144-25244166 TTTAAATCAGAGAGGGAGAAGGG + Intronic
971578436 4:28305247-28305269 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
972133342 4:35862962-35862984 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
972750784 4:41986559-41986581 AATTAAGCTGAGACAGAGCATGG - Intergenic
973097456 4:46220238-46220260 ATTTAAGCAGAGAGTGGACGTGG - Intergenic
973979020 4:56291162-56291184 ATTTGAGCAGAGAGAGAGTGAGG + Intronic
974526522 4:63055082-63055104 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
974537099 4:63186864-63186886 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
974838888 4:67280069-67280091 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
975595879 4:76047947-76047969 TTTAAATCAGAGAGGGAGAAGGG + Intronic
976174354 4:82336805-82336827 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
976190394 4:82481278-82481300 TTTTAAGCAGAGAGGTGGCGAGG + Intergenic
976321787 4:83725177-83725199 AGGGAAGCAGAGAGGGAGAAAGG - Intergenic
976513023 4:85932516-85932538 ATTTAAGGAGAAAGGGAGGAAGG - Intronic
976825533 4:89256455-89256477 ACTTAATAAGAGAGGCAGCAGGG + Intronic
977575711 4:98672016-98672038 TTTTAAGGAGACATGGAGCAAGG - Intergenic
977834957 4:101636038-101636060 TTTAAATCAGAGAGGGAGAAGGG + Intronic
978277400 4:106968183-106968205 ATGTAGGCAGAGAGGGAAAAAGG + Intronic
979120938 4:116900105-116900127 ATATATACAGAGAGAGAGCAAGG - Intergenic
979345406 4:119580766-119580788 ACTTAAGCAGAGAGGCAGAGTGG - Intronic
980724219 4:136737454-136737476 AACTAAGCAGATAGGGACCATGG - Intergenic
982088051 4:151856160-151856182 ATTAAGGAAGAAAGGGAGCATGG + Intergenic
982701087 4:158660217-158660239 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
982900044 4:160987635-160987657 ATTGAAGCAGAGACAGAGTAGGG + Intergenic
983193172 4:164776118-164776140 ATTCAAGTAGAGGGGGAGGAGGG - Intergenic
983834963 4:172374936-172374958 TTTAAATCAGAGAGGGAGAAGGG + Intronic
984067750 4:175070100-175070122 ATGCAAGCAGAGATGGGGCAAGG + Intergenic
984088200 4:175338293-175338315 AGTTAAGCAGAGAGGCATCTTGG - Intergenic
984916045 4:184725729-184725751 AGTAAAGCAGAGAGGAAGTAAGG - Intronic
984964984 4:185131658-185131680 AGTTAAGCAGAGAGGCCTCAGGG + Intergenic
986933270 5:12853704-12853726 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
987468602 5:18302829-18302851 GTTTAACCAGAGAAAGAGCATGG + Intergenic
987545286 5:19305085-19305107 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
988592057 5:32557626-32557648 TTTAAATCAGAGAGGGAGAAGGG + Intronic
988605538 5:32675747-32675769 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
989807666 5:45630243-45630265 ATTTAAGCAGAGAGGGAGCAAGG + Intronic
989957309 5:50372576-50372598 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
990116692 5:52399539-52399561 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
990310534 5:54533845-54533867 ATTAGAGCAGAGAGGGGGAAGGG + Intronic
990496713 5:56355318-56355340 CTTGAAGCAGAGAGGAAGAAGGG - Intergenic
990791767 5:59488843-59488865 TTTTAGGGAGAGTGGGAGCAAGG + Intronic
992545733 5:77812249-77812271 TTTAAATCAGAGAGGGAGAAGGG - Intronic
993777425 5:92017115-92017137 AATGAAGCAGAGCAGGAGCATGG + Intergenic
994200587 5:96970782-96970804 AATTAAGCAGAAAGGAAGAAGGG - Intronic
994231775 5:97316029-97316051 TTTAAATCAGAGAGGGAGAAAGG + Intergenic
994293949 5:98066138-98066160 ATGTTAACTGAGAGGGAGCATGG - Intergenic
995583464 5:113623567-113623589 TTTAAATCAGAGAGGGAGAAAGG + Intergenic
995706398 5:114992623-114992645 ATTAAATCAGAGAGGGAGAAGGG - Intergenic
996680341 5:126223538-126223560 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
996752185 5:126900071-126900093 ATTAAATCAGAGAGTTAGCAAGG - Intronic
997721843 5:136084330-136084352 GTGAAAGGAGAGAGGGAGCAAGG + Intergenic
998914614 5:147000353-147000375 CTTTAAACAGAGAGGCAGTAGGG + Intronic
999941365 5:156546816-156546838 ATTTAAGCAAAGAAATAGCATGG + Intronic
1000057296 5:157618710-157618732 CTTTTAGCAGAGAGGGGACATGG + Intergenic
1000085183 5:157882258-157882280 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1002809847 6:616916-616938 TTTTTAGTAGAGAGGGAGGAGGG + Intronic
1002810534 6:623635-623657 GTTTCAGCAGAGAGGGTCCAGGG - Intronic
1002876020 6:1209951-1209973 ACATGAGCAGAGAGGTAGCAGGG + Intergenic
1003450621 6:6228331-6228353 AGTAAAGCAGAGAGGCAACATGG + Intronic
1003805747 6:9724536-9724558 TTTAAATCAGAGAGGGAGAAGGG - Intronic
1003893316 6:10583281-10583303 AGTGGAGCAGAGAGGGGGCAGGG + Intronic
1004281047 6:14280257-14280279 TTGCAGGCAGAGAGGGAGCAAGG + Intergenic
1004812195 6:19273455-19273477 TTTAAATCAGAGAGGGAGAATGG - Intergenic
1006221740 6:32497263-32497285 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1006934090 6:37705444-37705466 GGTTAAACAGAAAGGGAGCAAGG - Intergenic
1007074982 6:39060594-39060616 ATCAAGGCAGGGAGGGAGCAGGG + Intronic
1008306792 6:49912739-49912761 ATTTAAGGAGAGAGAGAAGAGGG + Intergenic
1008745758 6:54667787-54667809 CTTTCAGCAGAGAGGGGACATGG - Intergenic
1008883348 6:56405032-56405054 ATTTACACATAGAGGGAGTAGGG + Intergenic
1009385984 6:63084558-63084580 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1009407751 6:63330987-63331009 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1009470757 6:64026863-64026885 TTTAAATCAGAGAGGGAGAAGGG - Intronic
1009766158 6:68078766-68078788 ATTTAAGCAGAGAATGGACAGGG - Intergenic
1010581937 6:77610007-77610029 TTTTCAGCAGAGAGGTAACATGG + Intergenic
1011375094 6:86679147-86679169 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1011554557 6:88561165-88561187 ATGAGAGGAGAGAGGGAGCAAGG - Intergenic
1012528183 6:100202592-100202614 CTTAAAGCAGAGAGGGGTCAGGG - Intergenic
1013977375 6:116093333-116093355 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1014042760 6:116849142-116849164 ATAGAAGGAGAGAGAGAGCAAGG - Intergenic
1014479869 6:121922465-121922487 ACTCAAGCACAGAGGGAGCTAGG + Intergenic
1015446285 6:133308968-133308990 ATTGAATCAGAGAGGAAGCAAGG + Intronic
1015457833 6:133448952-133448974 ATTTCATCAGAGATAGAGCAAGG - Intronic
1015868704 6:137754013-137754035 AATTCAGAAGAGAGGGACCATGG - Intergenic
1016183980 6:141178402-141178424 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1016241215 6:141933824-141933846 TTTTAACCAGACAGTGAGCAAGG + Intergenic
1016379174 6:143456176-143456198 ATTTAGACACAGAGGGAGGAAGG + Intronic
1017036442 6:150271500-150271522 ATTTAAGTAGAAAGGGAGGCAGG - Intergenic
1017207836 6:151823189-151823211 CATTAAGCAGAAAGGCAGCATGG - Intronic
1017869468 6:158474555-158474577 CTTTTTGAAGAGAGGGAGCAGGG - Intronic
1017915368 6:158827410-158827432 AGATTAGCAGAGAGGGTGCAGGG + Intergenic
1019076855 6:169394841-169394863 TCTTCAGCAGAGAGGGAACATGG + Intergenic
1019227149 6:170522739-170522761 ATTTCATAAGTGAGGGAGCAAGG + Intergenic
1020968631 7:14904427-14904449 AATTAAACAGAGGGGGAACACGG + Intronic
1021269538 7:18568696-18568718 ATTATAGCAGAGAGGTAGCTTGG + Intronic
1023078006 7:36502522-36502544 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1023125056 7:36947116-36947138 CCCAAAGCAGAGAGGGAGCAGGG - Intronic
1024735234 7:52297054-52297076 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1024870837 7:53960450-53960472 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1024985406 7:55189607-55189629 TTTTAAATAGAGAGGGAGAAAGG + Intronic
1025048566 7:55714300-55714322 AGTTAAACACAGAGGCAGCATGG + Intergenic
1026188245 7:68100959-68100981 ATTAAAGCAGAAAAAGAGCAAGG + Intergenic
1027560491 7:79722539-79722561 ATTTAAACAGACAGGAAGTAAGG + Intergenic
1027953532 7:84850796-84850818 GTTTATGCAGAGAGGGTACATGG + Intergenic
1028495272 7:91454085-91454107 TTTAAATCAGAGAGGGAGAAAGG + Intergenic
1030323434 7:108194115-108194137 AGTTGTGCAAAGAGGGAGCATGG - Exonic
1030872996 7:114780755-114780777 AGATAATCAGAGAAGGAGCAGGG - Intergenic
1030929346 7:115503172-115503194 CTTTAAGGAGAGAGGGTGTAAGG - Intergenic
1031120566 7:117716841-117716863 AATGAAGCAGTGAGGGAGCGGGG + Intronic
1031312288 7:120213471-120213493 ATTTAAGGGGAGAGGGTGGAAGG + Intergenic
1031431555 7:121676796-121676818 AATGATGCAGAGAAGGAGCAGGG - Intergenic
1031731729 7:125310062-125310084 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1032244968 7:130203638-130203660 AATACAGCAGAAAGGGAGCAAGG - Intronic
1032339110 7:131054516-131054538 ATTTAGGAAGGGAGGGAGGAGGG + Intergenic
1033006705 7:137572941-137572963 ACTTAAGCAGAGATAGGGCAAGG - Intronic
1033166474 7:139042805-139042827 CTTTCAGTGGAGAGGGAGCAGGG - Intergenic
1033759300 7:144422682-144422704 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1034204859 7:149306504-149306526 ATTGCAGCAGAGAGTAAGCACGG - Intergenic
1034395627 7:150822525-150822547 ATTTCTGGAGAGAGGGAGAAAGG + Intergenic
1034580030 7:152034042-152034064 TTTAAATCAGAGAGGGAGAAAGG + Intronic
1034910549 7:154994521-154994543 TTTTATGCAGAGATGGTGCAAGG + Intronic
1035367060 7:158355903-158355925 AGATAAGCAGAGAGGCAGCAGGG - Intronic
1036275572 8:7348798-7348820 AATTGAACAGAGAGGAAGCAGGG - Intergenic
1036841111 8:12122313-12122335 AATTGAACAGAGAGGAAGCAGGG + Intergenic
1037472819 8:19227513-19227535 ATATAAGCAGAGAGCTAACAGGG - Intergenic
1037475256 8:19250982-19251004 ATTGAAGCAGAAAGGAAACAAGG - Intergenic
1038402748 8:27297916-27297938 TTTTAAGCAGAGGAGGGGCACGG + Intronic
1038429118 8:27485708-27485730 CTTTCAGCAGAGAGGGGACACGG + Intergenic
1038430838 8:27498162-27498184 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1038638734 8:29307219-29307241 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1039428119 8:37503734-37503756 ACTAAAGAAGAGAGAGAGCATGG + Intergenic
1039638785 8:39195251-39195273 ATTTAAGGGGAGAGGTGGCAAGG - Intronic
1039693229 8:39883255-39883277 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1039968383 8:42300114-42300136 AATTAATCAGTGAGGCAGCAAGG - Intronic
1040580095 8:48690593-48690615 CTTTCAGCAGAGAGAGCGCAGGG - Intergenic
1040667926 8:49654764-49654786 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1040971515 8:53141315-53141337 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1041978841 8:63831913-63831935 CTTTCAGCAGAGAGGGGACATGG - Intergenic
1042334926 8:67620084-67620106 ATTTCAGCTGATAGGCAGCAAGG - Intronic
1042654222 8:71077952-71077974 AGTTAGGAAGAGAAGGAGCAAGG + Intergenic
1042919558 8:73908254-73908276 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1043257001 8:78149853-78149875 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1043359265 8:79451916-79451938 ACTGAAGCAGGGAAGGAGCAGGG + Intergenic
1044370269 8:91402343-91402365 ATTTAAGAAAATAGGGAGCATGG - Intergenic
1045558923 8:103241859-103241881 ATTCCATCAGAGAGGGAGAAAGG - Intergenic
1045686405 8:104716988-104717010 ATTTAAGCAGACAGAAAGAATGG - Intronic
1045858494 8:106790798-106790820 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1046924205 8:119768753-119768775 ATTGAAGCAGAGAGGGAGAGGGG - Intronic
1047037875 8:120959666-120959688 ACTTATGCAGAGAGGGAGTTTGG + Intergenic
1047207935 8:122818484-122818506 AACTAGGCAGAGAGGGAGGAGGG - Intronic
1047537820 8:125735325-125735347 CTTTCAGCACAGAGGGAACACGG - Intergenic
1048411503 8:134178971-134178993 TTTTAAGAAGAGAGAGAGAAAGG - Intergenic
1048554907 8:135465989-135466011 ATTGAAGCAGAGAAAGAACAAGG - Intronic
1048843322 8:138583742-138583764 ATTTCGGAAGAGAGGGAACATGG - Intergenic
1050775639 9:9256813-9256835 TTATAAGCAGAGAGGCAGCTGGG - Intronic
1052231600 9:26161033-26161055 ATGAAGGCAGAGAGGTAGCAGGG + Intergenic
1052600891 9:30629283-30629305 AATTAATCAGAGAGGAGGCAGGG + Intergenic
1053465926 9:38308544-38308566 ATGGAAGCAGAGAGGGGCCAAGG - Intergenic
1053569961 9:39294334-39294356 ATCTAAGCAGAGAGGTATCCAGG + Intergenic
1053835922 9:42135364-42135386 ATCTAAGCAGAGAGGTATCCAGG + Intergenic
1054091590 9:60853336-60853358 ATCTAAGCAGAGAGGTATCCAGG + Intergenic
1054113005 9:61128910-61128932 ATCTAAGCAGAGAGGTATCCAGG + Intergenic
1054127188 9:61324676-61324698 ATCTAAGCAGAGAGGTATCCAGG - Intergenic
1054594710 9:67053280-67053302 ATCTAAGCAGAGAGGTATCCAGG - Intergenic
1054944618 9:70782985-70783007 ATTTAAATAGAGACTGAGCATGG - Intronic
1055870251 9:80868678-80868700 AGTTAAGGAGACAGGGATCAAGG - Intergenic
1056269475 9:84932829-84932851 AACTAAGCAGAGAGGAAGCCTGG + Intronic
1056392840 9:86155035-86155057 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1056515195 9:87343346-87343368 ATTTAGGGAGAGAGGAGGCAAGG - Intergenic
1057306585 9:93916006-93916028 AATTAAGTGGAGAGGCAGCAAGG + Intergenic
1058698993 9:107585562-107585584 ATTGAGGCTGAGAGAGAGCAGGG + Intergenic
1058941491 9:109816757-109816779 AGTTAAGGAGAGAGGGAACAAGG + Intronic
1059870701 9:118570929-118570951 ATTTTTGCAGAGATGGAGCCTGG - Intergenic
1059876245 9:118638316-118638338 ATTAGAGGAGAGAGGGAGGAAGG - Intergenic
1060243104 9:121921707-121921729 AGTTAGACAAAGAGGGAGCAGGG + Intronic
1060834562 9:126745355-126745377 ATTAATACAGAGATGGAGCAAGG + Intergenic
1061571633 9:131481460-131481482 ATTACAGGAGAGAGTGAGCAGGG - Intronic
1061736682 9:132665550-132665572 CTCTGAGCAGAGAGGGAGCAAGG + Intronic
1185559134 X:1045240-1045262 ATTAAAGAAGTGAGGGGGCAGGG - Intergenic
1186960073 X:14727002-14727024 ATTTGAGCAGATAAGGAGAAAGG + Intronic
1187787903 X:22913856-22913878 TTCTAAGCAGGAAGGGAGCATGG - Intergenic
1187998722 X:24957777-24957799 TTTTAAGCAGAGAAGGGGCATGG + Intronic
1188097460 X:26042353-26042375 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1188136463 X:26499710-26499732 TTTAAATCAGAGAGGGAGAATGG - Intergenic
1188948102 X:36333494-36333516 TTTTTAGGAGAGAGGGAGAATGG - Intronic
1189480634 X:41389791-41389813 ATTTCAGCAAAGAGGGAGTCAGG + Intergenic
1189515713 X:41711855-41711877 CTTTCAGCAGAGAGGGGACACGG - Intronic
1189808467 X:44758843-44758865 ATTTATAGAGAGAGGGAACAGGG + Intergenic
1191205999 X:57834773-57834795 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1192181737 X:68920505-68920527 GTTGAAGGAGAGAGGGAGGAAGG - Intergenic
1192422242 X:71044096-71044118 ATGTTAGCAGACAGGGAGCTTGG - Intergenic
1192482823 X:71499954-71499976 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1192534767 X:71917836-71917858 ATTCAGGAGGAGAGGGAGCAAGG + Intergenic
1192870074 X:75176513-75176535 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1193864616 X:86715796-86715818 CTTTAAGAAGAGAGGAGGCAGGG + Intronic
1194756356 X:97743646-97743668 ATGAAAGCAGCCAGGGAGCAGGG + Intergenic
1195439509 X:104884992-104885014 TTTAAATCAGAGAGGGAGAAGGG - Intronic
1195552445 X:106184777-106184799 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1195694243 X:107655125-107655147 AGTGAGGCAGAGAAGGAGCACGG + Intergenic
1195989676 X:110670271-110670293 ATATAAGGAGAAAGGGAACATGG + Intergenic
1196419446 X:115507386-115507408 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1196488929 X:116245740-116245762 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
1196662003 X:118279681-118279703 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1198220181 X:134591932-134591954 ATTTAACCAAAGAGGAAACATGG - Intronic
1199095308 X:143731422-143731444 ATTAAAACTGAGAGGAAGCAGGG + Intergenic
1199746369 X:150774375-150774397 GTTTTAGAGGAGAGGGAGCAAGG - Intronic
1199832468 X:151559975-151559997 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1200322621 X:155205720-155205742 ATGGAAGCAGAGAGGAAGCATGG - Intronic
1200801078 Y:7387632-7387654 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1200966714 Y:9045524-9045546 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1201271981 Y:12264455-12264477 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1201429634 Y:13891189-13891211 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1201496458 Y:14595160-14595182 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1201989566 Y:20009245-20009267 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202048915 Y:20760916-20760938 ATTTAAGCAGACAAGGCTCAAGG - Intronic
1202074752 Y:21026860-21026882 TTTAAATCAGAGAGGGAGAAAGG + Intergenic
1202089923 Y:21178780-21178802 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202146745 Y:21806652-21806674 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202192667 Y:22260621-22260643 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202257769 Y:22939248-22939270 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1202272116 Y:23082688-23082710 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202293910 Y:23337994-23338016 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1202410759 Y:24572995-24573017 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1202425113 Y:24716432-24716454 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202445676 Y:24953653-24953675 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1202460022 Y:25097077-25097099 TTTAAATCAGAGAGGGAGAAGGG + Intergenic