ID: 989810412

View in Genome Browser
Species Human (GRCh38)
Location 5:45666008-45666030
Sequence TGTCAAGAAGAGAACTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989810412_989810421 26 Left 989810412 5:45666008-45666030 CCCCCCAAGTTCTCTTCTTGACA 0: 1
1: 0
2: 0
3: 11
4: 205
Right 989810421 5:45666057-45666079 ACTCCTCCAGCATAATCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989810412 Original CRISPR TGTCAAGAAGAGAACTTGGG GGG (reversed) Intronic
904423307 1:30407857-30407879 TGGCAAAGAGAGAACTGGGGAGG - Intergenic
905302577 1:36995860-36995882 GGGCATGATGAGAACTTGGGAGG - Intronic
907358462 1:53895533-53895555 TGGCAGGAAGAGAAGCTGGGAGG - Intronic
907395377 1:54185965-54185987 AGACAAGAAGAGAGCTTGTGCGG - Intronic
910750517 1:90624736-90624758 TGTTAAGAAGGGAAATTGAGCGG + Intergenic
910980702 1:92958094-92958116 TGTGAAGAAAAGAACTTGTGTGG - Intronic
912670345 1:111619512-111619534 ATTCAAGAAGAGAATTTGGAGGG - Intronic
912762949 1:112385369-112385391 TGTCTGGAAGAGAAGATGGGAGG + Intergenic
913163236 1:116164358-116164380 TGTCAACAGGAGAAATGGGGAGG - Intergenic
914889935 1:151612922-151612944 GCTGAAGATGAGAACTTGGGGGG - Intronic
915865353 1:159493624-159493646 TTTCAAGCACAAAACTTGGGCGG - Intergenic
917218923 1:172706693-172706715 TGGCAGGAACAGAAATTGGGAGG - Intergenic
917447823 1:175121566-175121588 TGACAAGGATAGAAGTTGGGAGG + Intronic
919687364 1:200496725-200496747 TGTCAAGAAGATAATTTGGCAGG - Intergenic
921319001 1:213919136-213919158 GCTCAAGAAGAGCACTTGGCAGG + Intergenic
923385296 1:233460055-233460077 TGTACAGAATAGCACTTGGGAGG + Intergenic
1069789665 10:71011577-71011599 TGTCATGGTGAGAACTGGGGAGG + Intergenic
1070284812 10:75075248-75075270 AGTCAAGAGGAGAATTTGGTGGG + Intergenic
1070726970 10:78798840-78798862 TGTCAAGAGGAAGACATGGGTGG + Intergenic
1073122164 10:101129049-101129071 TGGGAAGAAGAGAACTGGCGAGG + Intronic
1073749922 10:106513600-106513622 TGTCAATAAGAGAAATTGCAGGG - Intergenic
1074946320 10:118284123-118284145 TGTCTAGAACAGCACTTGGTAGG + Intergenic
1075550739 10:123390759-123390781 TGGAAAGAAGAGAACTTGTCAGG - Intergenic
1077239467 11:1502989-1503011 TGTGCAGAAGAGAGCTGGGGAGG + Intergenic
1077830602 11:5865694-5865716 TGTCAAGAAGAGTACTTCTATGG - Intronic
1081875815 11:46407752-46407774 TGCCCAGAAGAGACCATGGGAGG - Intronic
1081929623 11:46859897-46859919 TGTTAAGGAGAAAACTTGGGAGG + Intronic
1082733631 11:56830839-56830861 TGTCAAGAAGAGTACTTTCTAGG - Intergenic
1084673385 11:70620637-70620659 TGTCAACATAGGAACTTGGGGGG - Intronic
1090064270 11:123489694-123489716 TGGGAAGAAGAGAAATAGGGAGG + Intergenic
1090630653 11:128644365-128644387 GGCCAAGAAGGGAACATGGGAGG - Intergenic
1090679805 11:129042849-129042871 TCTCATGAAGAGGACTTGGGGGG + Intronic
1090934885 11:131332699-131332721 TGTCAAGGAAAGCAGTTGGGAGG + Intergenic
1092609807 12:10160241-10160263 TGGCAAGAAGAGGACATTGGTGG + Intronic
1096080377 12:48828650-48828672 TGTGTAGCAGAGAACTTAGGGGG + Exonic
1096203417 12:49702793-49702815 AGGCTAGAATAGAACTTGGGAGG - Intronic
1096536926 12:52280863-52280885 TGTCAACAAGGGAACTTTGTGGG + Intronic
1098481812 12:70970579-70970601 TGTCAAGAAGAGAGCATGTTTGG - Intergenic
1098583937 12:72134215-72134237 TGTCCAGAAATGAACTTAGGGGG - Intronic
1099634793 12:85199848-85199870 ATTCAAGAAGAGATTTTGGGTGG + Intronic
1100405481 12:94268999-94269021 TGTCAAGAGTGGAACTTTGGAGG + Intronic
1101211328 12:102537995-102538017 TGTTAAGGAAATAACTTGGGAGG + Intergenic
1101799413 12:108007596-108007618 TCTCAAGATGAGAACTTTGAAGG + Intergenic
1102554003 12:113713900-113713922 TGCCAAGAACAGAAGCTGGGAGG + Intergenic
1102855358 12:116288763-116288785 TGTGGAGAATAGAACTTAGGAGG - Intergenic
1103113364 12:118302533-118302555 TGTAAAGAAGAGATCTTTGCTGG + Intronic
1103258340 12:119562782-119562804 TGTCTAGCAGAGAACTTAGGAGG + Intergenic
1106809708 13:33348423-33348445 TTTCAAGAAGAGATCTGGGAAGG - Intronic
1110557671 13:76878500-76878522 AGTAAAGCAGAGAACTTAGGAGG + Intergenic
1113389062 13:109878367-109878389 TGTCAACATGTGAATTTGGGAGG - Intergenic
1114394105 14:22341332-22341354 TGTCAAGAAGAAGATATGGGTGG + Intergenic
1115678687 14:35711770-35711792 TTTTAAAAAGAGGACTTGGGTGG - Intronic
1124400855 15:29346132-29346154 CGCCAAGAAGAGAACCTGGAGGG + Intronic
1127827981 15:62722517-62722539 TGTCAGGAAGGGAGCTGGGGTGG + Intronic
1128608829 15:69058084-69058106 TGTCAAGAAGAGAACCTATCAGG - Intronic
1130820610 15:87491307-87491329 ATTCAAGATGAGAATTTGGGTGG - Intergenic
1131431068 15:92389514-92389536 TATCAGCAAGAGATCTTGGGAGG - Intergenic
1131926236 15:97387008-97387030 TGACAAGAAGAGAAATTGTTAGG + Intergenic
1135730093 16:24887131-24887153 TGGCAAACAGAGAACTTGGCTGG - Intronic
1136240124 16:28938450-28938472 GGTCAAGAACAGAACTGGGCTGG - Intronic
1137464790 16:48698201-48698223 TTTCAAGTAGATAATTTGGGAGG - Intergenic
1137516482 16:49148898-49148920 GGCCCAGAAGAGAACTTGGTTGG - Intergenic
1139651294 16:68363545-68363567 TGTCCAGCAGAGTACCTGGGGGG + Exonic
1139799812 16:69513406-69513428 TGGCTAGAAGAGGACATGGGGGG + Intergenic
1141685407 16:85567072-85567094 TTTCCAGGAGAGAAATTGGGCGG - Intergenic
1144087688 17:11825635-11825657 TGGCAAGATCAGGACTTGGGAGG - Intronic
1146502118 17:33373115-33373137 TGCCAAGAAGAGAACCCAGGAGG + Intronic
1146980586 17:37157856-37157878 TGTTGAGAACAGACCTTGGGTGG + Intronic
1149623042 17:58060431-58060453 TGTGTAGGAGAGAACTTGGGGGG - Intergenic
1150453733 17:65290543-65290565 TGCCAAGAAGAAAACTAGGAAGG + Intergenic
1152333437 17:79686414-79686436 TGGGAAGACGAGAACTGGGGGGG + Intergenic
1152611019 17:81315052-81315074 TGTCCAGCAGAGACCCTGGGGGG - Intronic
1153286645 18:3462203-3462225 TGTCAAGGACAGAAATGGGGTGG - Intergenic
1153571491 18:6477694-6477716 TGTCAAGAACAGAACCTGGAAGG - Intergenic
1156702223 18:39839759-39839781 TTTCCAGAAGAGAAGGTGGGAGG + Intergenic
1158020835 18:52839553-52839575 TGTCAAGAAGAGGGCTGGTGGGG - Intronic
1158282603 18:55843809-55843831 GAACAAGAAGAGAACATGGGTGG - Intergenic
1158348404 18:56539280-56539302 TGTCCAGAAGAGAAATTGCTGGG - Intergenic
1158394098 18:57066242-57066264 AAACAAGAAGAGGACTTGGGAGG + Intergenic
1159083273 18:63759635-63759657 ATTCAAGATGAGAATTTGGGTGG - Intronic
1160448990 18:78949250-78949272 TGTCAACATGGGAATTTGGGGGG - Intergenic
1164402775 19:27913073-27913095 TGTCCAGAAGAAAACTTTTGTGG + Intergenic
1164411892 19:28013108-28013130 TCTCAACTAGAAAACTTGGGAGG + Intergenic
1164674790 19:30094071-30094093 TGGAAAGAACAGAACTTGAGGGG - Intergenic
1166993043 19:46704689-46704711 TCTCAAGAAGAGACCTAGGAGGG - Intronic
925519733 2:4730210-4730232 TTTCAAGAAGAGATTTTGGGAGG + Intergenic
925582474 2:5425221-5425243 TGTCAACATGTGAATTTGGGGGG + Intergenic
925600905 2:5607921-5607943 TGTGAAGGAGAGAACCTGAGTGG + Intergenic
927101152 2:19788782-19788804 TGTCAAGGGGAGACCTTGGAGGG - Intergenic
928282425 2:29960361-29960383 TGTCAAGAAGAGTATTTCGTAGG - Intergenic
929996344 2:46828493-46828515 TGTCAAGAGGAGGACTCTGGAGG - Intronic
930031057 2:47058270-47058292 AGTGGAGATGAGAACTTGGGAGG - Intronic
931925157 2:67064487-67064509 TTTCAAGAAGAGAAAATGGCAGG - Intergenic
934729256 2:96646402-96646424 TATCAAGAAAAGAACTCGTGTGG + Intergenic
935389179 2:102532485-102532507 AGCCAAGAAGAGTACTTGGGTGG + Exonic
940751888 2:157635262-157635284 TATCAAGAAAACAACATGGGGGG + Intergenic
941118617 2:161502346-161502368 AGTCAAGAAGAAAACTAGGAAGG - Intronic
941317080 2:164007024-164007046 TGTCCAGAAGAGGAAATGGGTGG + Intergenic
941385013 2:164841654-164841676 TTTCCCGAAGAGAAGTTGGGAGG + Intronic
941598103 2:167503655-167503677 GTTCAAGAAGAGAAATTGAGTGG - Intergenic
943379652 2:187128383-187128405 TGTCAAGGAGACTAGTTGGGAGG - Intergenic
946617510 2:221525800-221525822 TGCCAAGAAAAGAAGCTGGGAGG + Intronic
946863549 2:224022769-224022791 ATTCAAGAAGAGATTTTGGGTGG - Intronic
947830051 2:233133278-233133300 TGTGAGGAAGAGACATTGGGTGG + Intronic
1172019159 20:31900721-31900743 TGTCATGAAAAGTGCTTGGGGGG + Intronic
1172614154 20:36272687-36272709 TGACAAAAAGGGAACTGGGGAGG - Intergenic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1175287111 20:57844361-57844383 TGTGAAGGTGAGGACTTGGGTGG + Intergenic
1179597083 21:42450174-42450196 AGTCAACAAGAGAATGTGGGTGG - Intergenic
1180735179 22:18011247-18011269 TATCAAGAAGAGAAGCTGGCTGG + Intronic
949284437 3:2384351-2384373 TGGTAAGATGAGAACTTTGGTGG - Intronic
949881792 3:8667023-8667045 TGTGAAGCAGAGAACGTGCGTGG - Intronic
950271204 3:11616529-11616551 TCTCAATAAGAGAGCATGGGTGG - Intronic
951159298 3:19397272-19397294 TGGCAAGAAGAGCACTGGGCTGG + Intronic
951166812 3:19492257-19492279 TGTCAAGAAGAGTACTTCCTAGG + Intronic
951317102 3:21201544-21201566 TTCCAAGATGAGAATTTGGGTGG - Intergenic
955856882 3:63281714-63281736 TTTCAACATGTGAACTTGGGGGG + Intronic
956312554 3:67897470-67897492 TGTGAAGAAGAAAAATTGGCAGG - Intergenic
957014121 3:75043534-75043556 ATTCAAGAAGAGATTTTGGGTGG - Intergenic
957205583 3:77194250-77194272 TGACAAGAAGAGATCTTCAGTGG - Intronic
959515492 3:107261789-107261811 TTTCAAGATGAGATTTTGGGTGG + Intergenic
960082793 3:113558966-113558988 TCTCAAGAAGATAAATTGAGAGG - Intronic
962231273 3:133667605-133667627 TGTCTAGGAAAGAACTAGGGAGG + Intergenic
962958939 3:140292146-140292168 TGGCAAGAGGAGTGCTTGGGAGG - Intronic
964086220 3:152821967-152821989 TGTCAAGAAGAAAGATTGAGAGG + Intergenic
964879312 3:161406075-161406097 TGTCAAGGAGAGGGCTTAGGTGG + Intergenic
965272356 3:166634879-166634901 AGACAAGAAGAGAAATGGGGAGG - Intergenic
966074161 3:175916437-175916459 ATTCAAGAAGAGATTTTGGGTGG + Intergenic
967743595 3:193030110-193030132 TCTTAAAAAGAGAACTTGAGAGG + Intergenic
968046687 3:195628049-195628071 TGTGAAGAAGAGAAAGTGAGTGG - Intergenic
968307968 3:197661995-197662017 TGTGAAGAAGAGAAAGTGAGTGG + Intergenic
968634112 4:1669045-1669067 TTTCCAGAAGAGAACTCGCGTGG - Intronic
969569543 4:8000583-8000605 TGTCCAGAAGAGCACCTGAGGGG - Intronic
969685745 4:8673121-8673143 TGGTAAGAGGAGAACTGGGGTGG - Intergenic
969890421 4:10255008-10255030 TGTCAAGAAGATAATCTGGTCGG + Intergenic
970697441 4:18694909-18694931 AGTCAAGTAGAGAAGTTGAGCGG - Intergenic
972174438 4:36386199-36386221 AGCCAAGAAGGGAACCTGGGCGG + Intergenic
973982902 4:56321218-56321240 TGTCAAGAGAAGCACTTGTGTGG + Intronic
974939982 4:68455557-68455579 TGTCAAGAAGAAGATTTGGTAGG + Intronic
976492567 4:85688659-85688681 TGTCAAGAAGAGAATTTCCTAGG + Intronic
976568888 4:86585788-86585810 TGTCTAGTAGAAAACTTAGGAGG - Intronic
978347316 4:107785405-107785427 TGTCAAGAAGGGAACTTTCCAGG - Intergenic
979724200 4:123941448-123941470 TGTCAAGAAGAGAAAATAGCTGG - Intergenic
980274921 4:130637908-130637930 TGCCAGGAAGAGAAATTTGGAGG + Intergenic
981530323 4:145746477-145746499 TGCCAAGAACATACCTTGGGGGG - Intronic
982984577 4:162189934-162189956 TGACAAGAAGAAAACATAGGAGG - Intergenic
983988408 4:174089046-174089068 TTTCAAGAAAGTAACTTGGGAGG - Intergenic
985744934 5:1641103-1641125 TGTGAAGAAGAGAAAGTGAGTGG + Intergenic
987469049 5:18308249-18308271 TGACAAGAACAGAACTAGTGTGG - Intergenic
989810412 5:45666008-45666030 TGTCAAGAAGAGAACTTGGGGGG - Intronic
990201183 5:53376635-53376657 TGTCAAAAAGAGACCATTGGCGG + Intergenic
992653801 5:78888171-78888193 TGTCAAGAAGTGATGTGGGGAGG - Intronic
994030804 5:95140382-95140404 AGTCCAGAAGAGACCTTAGGAGG + Intronic
994728397 5:103463287-103463309 TGCCTAGAAGAGAACTAGGTAGG + Intergenic
997906075 5:137818636-137818658 TGTCAGGCAGATAACTTGGCGGG - Intergenic
998158853 5:139801799-139801821 GCTCAAGAAGAGAAACTGGGTGG - Intronic
999792154 5:154950842-154950864 TGTCAAGAGAAGCACTTGTGTGG - Exonic
1002285431 5:178159748-178159770 TGTCAACAATAGACTTTGGGTGG - Intergenic
1002759409 6:190186-190208 TTTGAAGAAGAGAGCTTGTGTGG - Intergenic
1008409410 6:51155858-51155880 TGTCACTAAAAGGACTTGGGAGG - Intergenic
1008862687 6:56169004-56169026 GGTCAAGAAGAAAACTCTGGGGG - Intronic
1009550920 6:65090131-65090153 ATTCAAGATGAGATCTTGGGTGG - Intronic
1013871975 6:114775053-114775075 TGTCATGAGGAGCACTTTGGAGG - Intergenic
1013947351 6:115736749-115736771 GTTCAAGAAGAGATTTTGGGTGG - Intergenic
1015430760 6:133128241-133128263 GAGCAAGAATAGAACTTGGGAGG + Intergenic
1018104352 6:160468636-160468658 AGTCAAGATGAGATTTTGGGTGG + Intergenic
1018112542 6:160549234-160549256 AGTCAAGATGAGATTTTGGGTGG + Intronic
1018152954 6:160957041-160957063 TGGCAGGAAGAGAGCTGGGGAGG + Intergenic
1018219637 6:161565392-161565414 ATTCAAGATGAGAATTTGGGTGG - Intronic
1019769983 7:2877484-2877506 TGGCAAGAGGTGAACCTGGGGGG - Intergenic
1023447241 7:40244471-40244493 GGTCAAGTAAAGAAGTTGGGAGG + Intronic
1023887704 7:44373132-44373154 TGTGCGGAAGATAACTTGGGTGG + Intergenic
1024844964 7:53632873-53632895 TGACAAGCAGAGAACTGAGGAGG + Intergenic
1027005686 7:74690700-74690722 TGTCAATTACAGCACTTGGGAGG - Intronic
1027198009 7:76044528-76044550 TGTGGAGATGAGGACTTGGGAGG + Intronic
1028266865 7:88736488-88736510 TGTTAAGAAAACAATTTGGGAGG + Intergenic
1028868818 7:95743252-95743274 ATTCAAGATGAGAATTTGGGTGG - Intergenic
1029315307 7:99707052-99707074 GGTCAAGAAGACACCTTGGAGGG + Intronic
1031428354 7:121635473-121635495 ACTTTAGAAGAGAACTTGGGAGG - Intergenic
1031627245 7:124005088-124005110 TGTCAGTTAGAGAGCTTGGGTGG + Intergenic
1032243724 7:130188850-130188872 TGGCAAGAATACAACATGGGTGG - Intronic
1032804554 7:135341280-135341302 GGGCAAGAGGACAACTTGGGAGG - Intergenic
1033282829 7:140017882-140017904 TCTCACGCAGAGAACTGGGGTGG - Intronic
1033377669 7:140779183-140779205 TGGCTAGAAGAGGACATGGGAGG + Intronic
1034130912 7:148716612-148716634 TTTCAAGAAGAAAAATTGGGAGG - Intronic
1034438769 7:151076245-151076267 GGTCAAGAAGGGAAGTGGGGGGG - Intronic
1035645115 8:1213028-1213050 TCTCATGATGAGAATTTGGGAGG + Intergenic
1039071486 8:33652858-33652880 ATTCAAGAAGAGATTTTGGGTGG - Intergenic
1039605367 8:38876075-38876097 TGGCAAGGAGGGAACTTGGAAGG - Intergenic
1040486606 8:47878591-47878613 AGTCAAGATGAGAACATCGGGGG - Intronic
1044225766 8:89716442-89716464 TGTCAAGAAAGGGACTTGGTGGG + Intergenic
1044414415 8:91919819-91919841 ATTCAAGATGAGAATTTGGGTGG + Intergenic
1044773988 8:95668711-95668733 TGTCATGAAGTGAAGTAGGGAGG + Intergenic
1045837578 8:106540896-106540918 TGTCATGGAAAGAACTTGGTGGG - Intronic
1048774370 8:137929478-137929500 TGTCACACAGAGAACTTGGGAGG + Intergenic
1049519718 8:143081882-143081904 TGTTGAGAAAAGAGCTTGGGTGG - Intronic
1050612831 9:7371051-7371073 TGGCAGGAAGAGAACCAGGGCGG + Intergenic
1051191922 9:14522015-14522037 TGATAAGAAGAGAACATGTGAGG + Intergenic
1052282790 9:26752507-26752529 TGTTTAGAAGAGAACCTGGTTGG - Intergenic
1052634554 9:31085475-31085497 AGTAAAGAAGAGAATTAGGGTGG - Intergenic
1053862138 9:42397485-42397507 TGTAAAGAAAAGAAATTGGCTGG + Intergenic
1055447234 9:76395070-76395092 TGTCAAGAAGACAGCCTGGAGGG - Intergenic
1055695052 9:78874343-78874365 TGTAAAGAAGAAAAATTGGCAGG + Intergenic
1056218946 9:84432097-84432119 TGTCAAGAGGAAACCTTGTGAGG + Intergenic
1057787338 9:98096783-98096805 AGGCTGGAAGAGAACTTGGGAGG - Intronic
1058252301 9:102713964-102713986 AGTGAAGAAGAGAATGTGGGAGG - Intergenic
1058349976 9:104009919-104009941 TGTCAAGAGAGGAACTTGGTGGG + Intergenic
1058769269 9:108214721-108214743 GGAGAAGAAGAGAATTTGGGGGG - Intergenic
1060403495 9:123361558-123361580 TGTCTAGATGACAACCTGGGTGG + Intronic
1185483814 X:467522-467544 AGTCAGAAACAGAACTTGGGGGG - Intergenic
1186498369 X:10031032-10031054 TGTTAAGAATAGAAGTTGGCTGG + Intronic
1187969277 X:24643321-24643343 TGTCAAGATGAGAAACTGAGTGG - Intronic
1188987572 X:36781178-36781200 AGTCTAGAAGAGAACTTAGTAGG - Intergenic
1196642261 X:118075750-118075772 TGTCTAGTAGATAACTTGGATGG - Intronic
1198468492 X:136924630-136924652 TTTCAAACAGAAAACTTGGGTGG + Intergenic
1201298160 Y:12483031-12483053 TGTTAAAAATAGAAATTGGGCGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic