ID: 989812285

View in Genome Browser
Species Human (GRCh38)
Location 5:45693871-45693893
Sequence TTGCATGTTAATATTGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989812285 Original CRISPR TTGCATGTTAATATTGAACC TGG Intronic
910283965 1:85532509-85532531 TTGCATGTTTATTATGGACCAGG + Intronic
914206053 1:145530476-145530498 TTGCATGTTTATTATGGACCAGG - Intergenic
914915015 1:151814340-151814362 TTGCCTATTAAAATTGTACCTGG - Intronic
917807565 1:178627415-178627437 TTGCATGTAATGAGTGAACCAGG + Intergenic
917888491 1:179412703-179412725 TTGCATGTTATTACTGAATTAGG - Intronic
917910211 1:179636460-179636482 CTGCATTTTAATTTTGCACCAGG - Intronic
918115982 1:181498043-181498065 TTCCATGCTAATATTGAAAGGGG - Intronic
923930371 1:238687979-238688001 TTGCTTGTTAATACTTAAACAGG + Intergenic
924628937 1:245718972-245718994 TCACATGTTAATAGTGATCCTGG - Intergenic
1064278531 10:13929958-13929980 TTGCATGTTTATTATGTACCTGG - Intronic
1064889864 10:20159005-20159027 TTTCATTTTAATATTTAATCAGG + Intronic
1068843155 10:61638748-61638770 TTGCTTGTTTATATACAACCTGG - Intergenic
1069587021 10:69613789-69613811 TTGCATGTTAATGCTGAAATTGG - Intergenic
1070529512 10:77324397-77324419 TTGGATGTTTATAATGTACCAGG - Intronic
1071078977 10:81786703-81786725 CTGCATGTCAATATTGAATTAGG - Intergenic
1076837736 10:133029645-133029667 CTGCGTGACAATATTGAACCAGG + Intergenic
1078192378 11:9102035-9102057 TTGCATTTTAATTTTGCACGGGG - Intronic
1079206107 11:18416264-18416286 TTCTATGTTTATAGTGAACCAGG + Intronic
1080486832 11:32717181-32717203 TTGTTTGGTAATATTGAAACAGG - Intronic
1080700794 11:34642426-34642448 ATGCATATGAAAATTGAACCTGG + Intronic
1080804324 11:35638350-35638372 TTGTATGTTTATTTTAAACCAGG - Intergenic
1080965791 11:37212603-37212625 TTGTATGTTAATTTTGTATCTGG + Intergenic
1081049527 11:38320502-38320524 TTGTATGTTAATTTTGTATCCGG - Intergenic
1082033861 11:47627862-47627884 TTGTCTGTTAATATTGAATCAGG - Intronic
1083797912 11:65028650-65028672 CTGTATTTTAATATTGATCCGGG - Intronic
1086596833 11:88582569-88582591 TTTCTTGTTAATATTGAAACTGG - Intronic
1086867577 11:91998637-91998659 TCACAGGTAAATATTGAACCAGG + Intergenic
1088344998 11:108813617-108813639 TTTCATGTTAAAGTTGAACAGGG + Intronic
1088347774 11:108848507-108848529 TTCCATTTTAATAATAAACCTGG - Intronic
1088867174 11:113859403-113859425 TTGCATGTTATTCTTGCACAGGG - Intronic
1090131871 11:124151029-124151051 TTGCATGTTATAGTTGAAACTGG + Intergenic
1091005065 11:131945574-131945596 TTTTAGGTAAATATTGAACCTGG - Intronic
1093669158 12:21851929-21851951 TTGCATATTATTAATGAACAGGG - Intronic
1095159845 12:38904283-38904305 TTGCGAATTAATATTGACCCTGG - Intronic
1100807621 12:98303882-98303904 TTGCATCTTTATCTTTAACCTGG + Intergenic
1102326038 12:111985340-111985362 TTGCATGTTGATTTTGTATCTGG - Intronic
1104819908 12:131670682-131670704 TTGCATGTTGATTTTGTATCTGG - Intergenic
1105489282 13:20871912-20871934 TTGTATGATAATATTTAACCAGG - Intronic
1107370392 13:39739915-39739937 TAGTATGTTAATTTTGAATCTGG - Intronic
1109548004 13:63853906-63853928 TTGGATGTTAGTTTTGAACTTGG - Intergenic
1111364116 13:87218982-87219004 TTGCATATTGACATTGCACCTGG + Intergenic
1114960013 14:27874289-27874311 TTGAATGTTAATTTTGTATCCGG + Intergenic
1115735326 14:36321342-36321364 TTGCATGATATTATTTATCCAGG - Intergenic
1116647294 14:47545066-47545088 TTTCATTTAAATATTGAACTTGG - Intronic
1121243878 14:92449070-92449092 TTGCATCTTCACATTGTACCTGG - Exonic
1123154848 14:106214183-106214205 TTGCATGTTGGTATTGAAATGGG - Intergenic
1123181374 14:106473605-106473627 TTGCATGTTGGTATTGAAATGGG - Intergenic
1202945527 14_KI270726v1_random:23122-23144 TTGCATGTTGGTATTGAAATGGG + Intergenic
1123830254 15:24128573-24128595 TTGCATTGTAATATTTATCCTGG + Intergenic
1123845162 15:24292509-24292531 TTGCATTGTAATATTTATCCTGG + Intergenic
1123863945 15:24497814-24497836 TTGCATTGTAATATTTATCCTGG + Intergenic
1124417703 15:29487320-29487342 TTTCTTGTTTATACTGAACCTGG - Intronic
1134565422 16:15247663-15247685 TTGCATGGTAAAATTGCTCCTGG - Intergenic
1134737074 16:16509035-16509057 TTGCATGGTAAAATTGCTCCTGG + Intergenic
1134930446 16:18203129-18203151 TTGCATGGTAAAATTGCTCCTGG - Intergenic
1140579336 16:76210683-76210705 CTGCGTGTTATTATTGAATCTGG + Intergenic
1143353998 17:6311121-6311143 TTGGATGTTAAGACTGAACTGGG - Intergenic
1145356008 17:22152693-22152715 TTGTATGTTGATTTTGCACCTGG - Intergenic
1146565358 17:33908327-33908349 TTGGATGACAATATTGAGCCAGG + Intronic
1146814044 17:35928266-35928288 TGGCATGTTAATATGGAATAGGG + Intronic
1150516788 17:65820822-65820844 TTTCATATTAATATTGAATGCGG - Intronic
1150997149 17:70331702-70331724 TTACATGTTAATATTCAAAAGGG + Intergenic
1158566070 18:58555129-58555151 TTGTGTGTTAAGATTGTACCAGG - Intronic
1166424623 19:42665842-42665864 TTGCATGTTAATTTAGTATCCGG + Intronic
926269265 2:11352879-11352901 TTGCAAGTTAGTATAGGACCTGG - Intergenic
929959007 2:46482165-46482187 TTTCATGTTTATAATGAAGCAGG - Intronic
933316496 2:80721454-80721476 TTGCATGTTAATAGAGAAATAGG - Intergenic
936386664 2:112036092-112036114 TTGTATGTTTTTATTGAAACTGG + Intergenic
937755821 2:125537206-125537228 TAGCACTTTAATATTGAGCCAGG - Intergenic
941066577 2:160910000-160910022 TTGCATGTAAATATTTAGACTGG + Intergenic
941289480 2:163657912-163657934 TTGTAAGTTTATATTAAACCTGG - Intronic
943354014 2:186828982-186829004 TTGCATTTTAATATCGAAAATGG - Intronic
1169922795 20:10753485-10753507 GTGAATGTTAATACTGAATCAGG + Intergenic
1172822640 20:37751333-37751355 TTGCATGCTAATATTTAAGCAGG + Intronic
1175351414 20:58322947-58322969 TTTAATGTTTATATTGAAACAGG - Intronic
1177192331 21:17865852-17865874 TTGCAAGTTAAAATTGATCATGG - Intergenic
1178264582 21:31131138-31131160 TTCTATGTTTATTTTGAACCTGG - Intronic
1178302001 21:31460849-31460871 TTGCATCTTAATATAAAAACAGG - Intronic
1179314796 21:40233868-40233890 TTGCATGTTAAGATGGCTCCAGG + Intronic
950579020 3:13850755-13850777 CTCCATGATAATATTGTACCTGG - Intronic
951516364 3:23564448-23564470 TTGGGTGTTAAAATTGAACATGG - Intronic
951797041 3:26550921-26550943 TTGAATGGTAATTTTTAACCTGG - Intergenic
951801533 3:26602086-26602108 TTTCATGTTCATTTTGATCCAGG - Intergenic
952881169 3:37987099-37987121 CTCCATGTCAATATTGACCCAGG - Intergenic
953146724 3:40283364-40283386 TTGCATGTTAATTTCCAACTGGG + Intergenic
956369675 3:68545131-68545153 TTGCATGCTAATATTGCACAGGG - Exonic
957303485 3:78424615-78424637 TTGCAAGCTTATTTTGAACCAGG + Intergenic
959106111 3:102066604-102066626 TTGCTTCTTAATATTAAACAGGG - Intergenic
959962399 3:112313541-112313563 TTGTATGTTAAAACTGAAACTGG + Intergenic
960382055 3:116974981-116975003 TTGCATTTAAATAGTGAAACTGG + Intronic
960827444 3:121805503-121805525 CTGCATGTGGTTATTGAACCTGG - Intronic
962929789 3:140025816-140025838 TCGCATGTTCATCTTGAAACAGG - Intronic
964717028 3:159733248-159733270 TTTCAAATTAATATTGTACCAGG - Intronic
966309253 3:178575387-178575409 TGGTATGTTAATATTGACCCTGG - Intronic
970290835 4:14570490-14570512 ATGCATGTTTATATGGCACCAGG + Intergenic
975049851 4:69848999-69849021 TTCCATATTCATATAGAACCTGG + Intronic
975189407 4:71442418-71442440 TTGCATGTTAACATTTTTCCAGG + Intronic
975417677 4:74124074-74124096 TTGCCTGTTAAAATTGAACTAGG + Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977614749 4:99075532-99075554 ATTTATGTTAATATTTAACCAGG - Intronic
982244781 4:153340831-153340853 TTGCATTTTCATTTTGCACCAGG - Intergenic
984370432 4:178857711-178857733 TTAAATATTAATATTTAACCTGG + Intergenic
985124262 4:186675887-186675909 TTGGATCTTAATCTGGAACCTGG + Intronic
986935244 5:12876491-12876513 TTGCATGAGAATCTTGAAACTGG - Intergenic
987825541 5:23026227-23026249 TTGGTTTTTAATATAGAACCTGG + Intergenic
988314610 5:29608271-29608293 TTGCATTTTAATATTTAAATTGG - Intergenic
989567380 5:42914920-42914942 TTTCATATTAATAATGAAGCAGG - Intergenic
989812285 5:45693871-45693893 TTGCATGTTAATATTGAACCTGG + Intronic
991558639 5:67924717-67924739 TTGAATGCTAATGTTGACCCTGG + Intergenic
991725648 5:69533219-69533241 TTCCATGTTAATATTGACCTAGG + Intronic
991922615 5:71671812-71671834 TTGCATGGTGAAATTGATCCTGG + Intergenic
994304597 5:98187795-98187817 TTACATGTTTATACTGAACCTGG + Intergenic
994872150 5:105365503-105365525 TTGTATGTTAATTTTGTATCCGG - Intergenic
994921425 5:106048995-106049017 TTTCATGAGAAAATTGAACCAGG - Intergenic
995703813 5:114964232-114964254 TAGCATGTGAAGATTGAAACTGG - Intergenic
996143024 5:119938103-119938125 TTTTATTTTAATATTTAACCAGG - Intergenic
996222155 5:120947498-120947520 TTGCATAATGATTTTGAACCCGG + Intergenic
997014409 5:129915145-129915167 TAGCATGTTATTTTTGCACCAGG + Intronic
998845532 5:146305619-146305641 TTGCATTTTAATTTTGAAAAAGG + Intronic
999151606 5:149430075-149430097 TTGCATGTGATTATGGAACCTGG + Intergenic
1001717275 5:173826507-173826529 TTGCACGGTAATAATTAACCAGG + Intergenic
1002516507 5:179762960-179762982 TTGCATGTGAATATTGAATGAGG + Intronic
1006249765 6:32772369-32772391 TTTCATGAAAATATTCAACCTGG + Intergenic
1008033922 6:46726316-46726338 TTACATGTTAATATGGTTCCTGG - Intronic
1009040495 6:58170482-58170504 TTTAATGTTACTACTGAACCTGG - Intergenic
1009216351 6:60925019-60925041 TTTAATGTTACTACTGAACCTGG - Intergenic
1009608467 6:65905488-65905510 TACCATGTGAATATTGTACCTGG - Intergenic
1009823849 6:68840638-68840660 CTGCAGGTTAATAGAGAACCAGG + Intronic
1010992263 6:82492818-82492840 TTGCATATTCATTTTGAACTAGG - Intergenic
1011745977 6:90408090-90408112 TTGATTGTTTATATTGTACCAGG + Intergenic
1012702601 6:102479963-102479985 TTTTATGTAAACATTGAACCAGG - Intergenic
1014322486 6:119947612-119947634 TTGCATGTTCATAGTGATGCTGG - Intergenic
1014572463 6:123026697-123026719 TATCATGCTAATATTGTACCTGG + Intronic
1014789917 6:125660652-125660674 ATGCATGTTACTAGTGAATCTGG + Intergenic
1015618961 6:135109570-135109592 TTGTATGTTAATCTTGTATCTGG + Intergenic
1016222424 6:141691535-141691557 TTGCCTGTAAATCTTGAAACTGG - Intergenic
1016401327 6:143684063-143684085 TTGTATTTTAATATTGTTCCTGG + Intronic
1020684086 7:11272089-11272111 TTGAATGTTCATATAGAACAAGG + Intergenic
1022748547 7:33199398-33199420 TTGCCAGTTAATCTTGAAACTGG - Intronic
1023506849 7:40908707-40908729 TTTCATAGTAATATTGAATCAGG + Intergenic
1031062710 7:117070256-117070278 TCACAAGTTAATAGTGAACCAGG - Intronic
1032572727 7:133017697-133017719 TTACATGTTAATATCAAACCTGG - Intronic
1033022529 7:137740688-137740710 TGTCATGTGAATATTTAACCAGG + Intronic
1036391150 8:8325260-8325282 TTGCAAATTAATATTGTTCCTGG + Intronic
1039022681 8:33224921-33224943 TTGGATGTTAGTATTCAACAGGG - Intergenic
1039027394 8:33272355-33272377 TCGCATGTTCATATTCACCCAGG - Intergenic
1040476087 8:47779220-47779242 TTCAATGTTAATATTGAATATGG - Intronic
1042469416 8:69166910-69166932 ATCCATGGTAATATTGCACCTGG - Intergenic
1042577971 8:70242419-70242441 CTGCATGTTAACTGTGAACCTGG + Intronic
1042662836 8:71174560-71174582 TTGCATGTTAATGTTGTCTCTGG + Intergenic
1043395141 8:79828221-79828243 TTGCATCTTCATACTGAACAAGG + Intergenic
1043513953 8:80978673-80978695 TTGCAATTTAATATTGACTCTGG + Intronic
1043711528 8:83424442-83424464 TTGAATGTGAATGTTGAACCTGG - Intergenic
1044868703 8:96597475-96597497 TTGCCTGTTTATATTGAAGAGGG - Intronic
1045540840 8:103083235-103083257 TTGCTTATTAATTATGAACCAGG - Intergenic
1046181703 8:110657296-110657318 TTGCATGTTCATATTAATCGTGG - Intergenic
1048453040 8:134550854-134550876 TTTCTTGTTAATTTTGAACGTGG - Intronic
1052188171 9:25624135-25624157 CAGCATGTGAAGATTGAACCTGG - Intergenic
1052254461 9:26438116-26438138 TTGCATGTTAAAAATTGACCTGG - Intergenic
1054742820 9:68825972-68825994 TTGCATGTGATTATTGAGGCTGG + Intronic
1059128174 9:111714920-111714942 TTCCATGTAAATATAGATCCTGG - Intronic
1059128351 9:111716844-111716866 TTGAATGTTGATACTGGACCAGG + Intronic
1059973698 9:119693766-119693788 TTTTATTTTAATATAGAACCTGG + Intergenic
1188127530 X:26388140-26388162 TTCAATGTTAATAATGAACAAGG + Intergenic
1196914540 X:120518887-120518909 TTGCATGTTTATCTTGTATCTGG - Intergenic
1201380460 Y:13371397-13371419 TTGAATGTTGATTTTGAATCTGG - Intronic