ID: 989815077

View in Genome Browser
Species Human (GRCh38)
Location 5:45726244-45726266
Sequence AGTTATATATACTCACCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989815077_989815079 5 Left 989815077 5:45726244-45726266 CCATTAGGTGAGTATATATAACT No data
Right 989815079 5:45726272-45726294 GAGAAGTAAGTGGTGAATGTAGG No data
989815077_989815078 -5 Left 989815077 5:45726244-45726266 CCATTAGGTGAGTATATATAACT No data
Right 989815078 5:45726262-45726284 TAACTGCTTAGAGAAGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989815077 Original CRISPR AGTTATATATACTCACCTAA TGG (reversed) Intergenic
No off target data available for this crispr