ID: 989815078

View in Genome Browser
Species Human (GRCh38)
Location 5:45726262-45726284
Sequence TAACTGCTTAGAGAAGTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989815077_989815078 -5 Left 989815077 5:45726244-45726266 CCATTAGGTGAGTATATATAACT No data
Right 989815078 5:45726262-45726284 TAACTGCTTAGAGAAGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989815078 Original CRISPR TAACTGCTTAGAGAAGTAAG TGG Intergenic
No off target data available for this crispr