ID: 989819287

View in Genome Browser
Species Human (GRCh38)
Location 5:45775753-45775775
Sequence CTCTGTGAGTACATGTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989819287_989819290 4 Left 989819287 5:45775753-45775775 CCCATATACATGTACTCACAGAG No data
Right 989819290 5:45775780-45775802 ACAAACTCACAAATACATATGGG No data
989819287_989819289 3 Left 989819287 5:45775753-45775775 CCCATATACATGTACTCACAGAG No data
Right 989819289 5:45775779-45775801 CACAAACTCACAAATACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989819287 Original CRISPR CTCTGTGAGTACATGTATAT GGG (reversed) Intergenic
No off target data available for this crispr