ID: 989826309

View in Genome Browser
Species Human (GRCh38)
Location 5:45860532-45860554
Sequence ACTCCTGGCCTTACATAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989826305_989826309 20 Left 989826305 5:45860489-45860511 CCAAAATTCTCATCATGACACTT No data
Right 989826309 5:45860532-45860554 ACTCCTGGCCTTACATAACCAGG No data
989826304_989826309 21 Left 989826304 5:45860488-45860510 CCCAAAATTCTCATCATGACACT No data
Right 989826309 5:45860532-45860554 ACTCCTGGCCTTACATAACCAGG No data
989826303_989826309 22 Left 989826303 5:45860487-45860509 CCCCAAAATTCTCATCATGACAC No data
Right 989826309 5:45860532-45860554 ACTCCTGGCCTTACATAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989826309 Original CRISPR ACTCCTGGCCTTACATAACC AGG Intergenic
No off target data available for this crispr