ID: 989829679

View in Genome Browser
Species Human (GRCh38)
Location 5:45899926-45899948
Sequence ACAATGGATGTTCACACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989829679_989829682 11 Left 989829679 5:45899926-45899948 CCCTCTGTGTGAACATCCATTGT No data
Right 989829682 5:45899960-45899982 TTAATGATCACCAGTCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989829679 Original CRISPR ACAATGGATGTTCACACAGA GGG (reversed) Intergenic
No off target data available for this crispr