ID: 989844540

View in Genome Browser
Species Human (GRCh38)
Location 5:46124651-46124673
Sequence CAAGGTAAAAACAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989844540_989844545 1 Left 989844540 5:46124651-46124673 CCTTCCTTCTTGTTTTTACCTTG No data
Right 989844545 5:46124675-46124697 GATATTCACTTTTTTGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989844540 Original CRISPR CAAGGTAAAAACAAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr