ID: 989845884

View in Genome Browser
Species Human (GRCh38)
Location 5:46140388-46140410
Sequence AGAATCTGCGAGGAGATATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989845882_989845884 17 Left 989845882 5:46140348-46140370 CCTTTCTTTGGACTCAGCAGTTT No data
Right 989845884 5:46140388-46140410 AGAATCTGCGAGGAGATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989845884 Original CRISPR AGAATCTGCGAGGAGATATA TGG Intergenic
No off target data available for this crispr