ID: 989859871

View in Genome Browser
Species Human (GRCh38)
Location 5:46357441-46357463
Sequence GGAATCTGCAAGCAGACAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989859871_989859873 17 Left 989859871 5:46357441-46357463 CCAATTGTCTGCTTGCAGATTCC No data
Right 989859873 5:46357481-46357503 AAGCTGATCTATCAAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989859871 Original CRISPR GGAATCTGCAAGCAGACAAT TGG (reversed) Intergenic
No off target data available for this crispr