ID: 989956691

View in Genome Browser
Species Human (GRCh38)
Location 5:50368489-50368511
Sequence GGTAACCCAACCTTTCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989956691_989956699 17 Left 989956691 5:50368489-50368511 CCAGAGAGAAAGGTTGGGTTACC No data
Right 989956699 5:50368529-50368551 CACACTAACAGCGGATCTCTCGG No data
989956691_989956696 8 Left 989956691 5:50368489-50368511 CCAGAGAGAAAGGTTGGGTTACC No data
Right 989956696 5:50368520-50368542 GAAGCCCATCACACTAACAGCGG No data
989956691_989956700 28 Left 989956691 5:50368489-50368511 CCAGAGAGAAAGGTTGGGTTACC No data
Right 989956700 5:50368540-50368562 CGGATCTCTCGGCAGAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989956691 Original CRISPR GGTAACCCAACCTTTCTCTC TGG (reversed) Intergenic