ID: 989956694

View in Genome Browser
Species Human (GRCh38)
Location 5:50368510-50368532
Sequence TGTGATGGGCTTCCCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989956694_989956699 -4 Left 989956694 5:50368510-50368532 CCCACAAAGGGAAGCCCATCACA No data
Right 989956699 5:50368529-50368551 CACACTAACAGCGGATCTCTCGG No data
989956694_989956700 7 Left 989956694 5:50368510-50368532 CCCACAAAGGGAAGCCCATCACA No data
Right 989956700 5:50368540-50368562 CGGATCTCTCGGCAGAAACTAGG No data
989956694_989956702 26 Left 989956694 5:50368510-50368532 CCCACAAAGGGAAGCCCATCACA No data
Right 989956702 5:50368559-50368581 TAGGCAAGCCAGAAGAGAGTGGG No data
989956694_989956704 28 Left 989956694 5:50368510-50368532 CCCACAAAGGGAAGCCCATCACA No data
Right 989956704 5:50368561-50368583 GGCAAGCCAGAAGAGAGTGGGGG No data
989956694_989956703 27 Left 989956694 5:50368510-50368532 CCCACAAAGGGAAGCCCATCACA No data
Right 989956703 5:50368560-50368582 AGGCAAGCCAGAAGAGAGTGGGG No data
989956694_989956701 25 Left 989956694 5:50368510-50368532 CCCACAAAGGGAAGCCCATCACA No data
Right 989956701 5:50368558-50368580 CTAGGCAAGCCAGAAGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989956694 Original CRISPR TGTGATGGGCTTCCCTTTGT GGG (reversed) Intergenic