ID: 989956695

View in Genome Browser
Species Human (GRCh38)
Location 5:50368511-50368533
Sequence GTGTGATGGGCTTCCCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989956695_989956703 26 Left 989956695 5:50368511-50368533 CCACAAAGGGAAGCCCATCACAC No data
Right 989956703 5:50368560-50368582 AGGCAAGCCAGAAGAGAGTGGGG No data
989956695_989956700 6 Left 989956695 5:50368511-50368533 CCACAAAGGGAAGCCCATCACAC No data
Right 989956700 5:50368540-50368562 CGGATCTCTCGGCAGAAACTAGG No data
989956695_989956702 25 Left 989956695 5:50368511-50368533 CCACAAAGGGAAGCCCATCACAC No data
Right 989956702 5:50368559-50368581 TAGGCAAGCCAGAAGAGAGTGGG No data
989956695_989956704 27 Left 989956695 5:50368511-50368533 CCACAAAGGGAAGCCCATCACAC No data
Right 989956704 5:50368561-50368583 GGCAAGCCAGAAGAGAGTGGGGG No data
989956695_989956701 24 Left 989956695 5:50368511-50368533 CCACAAAGGGAAGCCCATCACAC No data
Right 989956701 5:50368558-50368580 CTAGGCAAGCCAGAAGAGAGTGG No data
989956695_989956699 -5 Left 989956695 5:50368511-50368533 CCACAAAGGGAAGCCCATCACAC No data
Right 989956699 5:50368529-50368551 CACACTAACAGCGGATCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989956695 Original CRISPR GTGTGATGGGCTTCCCTTTG TGG (reversed) Intergenic