ID: 989956696

View in Genome Browser
Species Human (GRCh38)
Location 5:50368520-50368542
Sequence GAAGCCCATCACACTAACAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989956691_989956696 8 Left 989956691 5:50368489-50368511 CCAGAGAGAAAGGTTGGGTTACC No data
Right 989956696 5:50368520-50368542 GAAGCCCATCACACTAACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989956696 Original CRISPR GAAGCCCATCACACTAACAG CGG Intergenic