ID: 989956697 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:50368524-50368546 |
| Sequence | AGATCCGCTGTTAGTGTGAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 5 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 989956697_989956700 | -7 | Left | 989956697 | 5:50368524-50368546 | CCCATCACACTAACAGCGGATCT | No data | ||
| Right | 989956700 | 5:50368540-50368562 | CGGATCTCTCGGCAGAAACTAGG | No data | ||||
| 989956697_989956702 | 12 | Left | 989956697 | 5:50368524-50368546 | CCCATCACACTAACAGCGGATCT | No data | ||
| Right | 989956702 | 5:50368559-50368581 | TAGGCAAGCCAGAAGAGAGTGGG | No data | ||||
| 989956697_989956701 | 11 | Left | 989956697 | 5:50368524-50368546 | CCCATCACACTAACAGCGGATCT | No data | ||
| Right | 989956701 | 5:50368558-50368580 | CTAGGCAAGCCAGAAGAGAGTGG | No data | ||||
| 989956697_989956703 | 13 | Left | 989956697 | 5:50368524-50368546 | CCCATCACACTAACAGCGGATCT | No data | ||
| Right | 989956703 | 5:50368560-50368582 | AGGCAAGCCAGAAGAGAGTGGGG | No data | ||||
| 989956697_989956704 | 14 | Left | 989956697 | 5:50368524-50368546 | CCCATCACACTAACAGCGGATCT | No data | ||
| Right | 989956704 | 5:50368561-50368583 | GGCAAGCCAGAAGAGAGTGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 989956697 | Original CRISPR | AGATCCGCTGTTAGTGTGAT GGG (reversed) | Intergenic | ||