ID: 989956699

View in Genome Browser
Species Human (GRCh38)
Location 5:50368529-50368551
Sequence CACACTAACAGCGGATCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989956694_989956699 -4 Left 989956694 5:50368510-50368532 CCCACAAAGGGAAGCCCATCACA No data
Right 989956699 5:50368529-50368551 CACACTAACAGCGGATCTCTCGG No data
989956695_989956699 -5 Left 989956695 5:50368511-50368533 CCACAAAGGGAAGCCCATCACAC No data
Right 989956699 5:50368529-50368551 CACACTAACAGCGGATCTCTCGG No data
989956691_989956699 17 Left 989956691 5:50368489-50368511 CCAGAGAGAAAGGTTGGGTTACC No data
Right 989956699 5:50368529-50368551 CACACTAACAGCGGATCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989956699 Original CRISPR CACACTAACAGCGGATCTCT CGG Intergenic