ID: 989956700

View in Genome Browser
Species Human (GRCh38)
Location 5:50368540-50368562
Sequence CGGATCTCTCGGCAGAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989956695_989956700 6 Left 989956695 5:50368511-50368533 CCACAAAGGGAAGCCCATCACAC 0: 72
1: 5978
2: 2868
3: 848
4: 416
Right 989956700 5:50368540-50368562 CGGATCTCTCGGCAGAAACTAGG No data
989956691_989956700 28 Left 989956691 5:50368489-50368511 CCAGAGAGAAAGGTTGGGTTACC 0: 817
1: 4622
2: 3012
3: 1362
4: 922
Right 989956700 5:50368540-50368562 CGGATCTCTCGGCAGAAACTAGG No data
989956694_989956700 7 Left 989956694 5:50368510-50368532 CCCACAAAGGGAAGCCCATCACA 0: 65
1: 4807
2: 4469
3: 1869
4: 1054
Right 989956700 5:50368540-50368562 CGGATCTCTCGGCAGAAACTAGG No data
989956698_989956700 -8 Left 989956698 5:50368525-50368547 CCATCACACTAACAGCGGATCTC 0: 19
1: 2543
2: 4800
3: 2665
4: 1556
Right 989956700 5:50368540-50368562 CGGATCTCTCGGCAGAAACTAGG No data
989956697_989956700 -7 Left 989956697 5:50368524-50368546 CCCATCACACTAACAGCGGATCT 0: 18
1: 2545
2: 4801
3: 2681
4: 2153
Right 989956700 5:50368540-50368562 CGGATCTCTCGGCAGAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989956700 Original CRISPR CGGATCTCTCGGCAGAAACT AGG Intergenic
No off target data available for this crispr