ID: 989956702

View in Genome Browser
Species Human (GRCh38)
Location 5:50368559-50368581
Sequence TAGGCAAGCCAGAAGAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989956695_989956702 25 Left 989956695 5:50368511-50368533 CCACAAAGGGAAGCCCATCACAC No data
Right 989956702 5:50368559-50368581 TAGGCAAGCCAGAAGAGAGTGGG No data
989956697_989956702 12 Left 989956697 5:50368524-50368546 CCCATCACACTAACAGCGGATCT No data
Right 989956702 5:50368559-50368581 TAGGCAAGCCAGAAGAGAGTGGG No data
989956694_989956702 26 Left 989956694 5:50368510-50368532 CCCACAAAGGGAAGCCCATCACA No data
Right 989956702 5:50368559-50368581 TAGGCAAGCCAGAAGAGAGTGGG No data
989956698_989956702 11 Left 989956698 5:50368525-50368547 CCATCACACTAACAGCGGATCTC No data
Right 989956702 5:50368559-50368581 TAGGCAAGCCAGAAGAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989956702 Original CRISPR TAGGCAAGCCAGAAGAGAGT GGG Intergenic