ID: 989960655

View in Genome Browser
Species Human (GRCh38)
Location 5:50410671-50410693
Sequence ATTGAGGAATAGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 2, 1: 0, 2: 2, 3: 38, 4: 449}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989960652_989960655 4 Left 989960652 5:50410644-50410666 CCTTTTGAACTAAAACATGTGCT 0: 1
1: 1
2: 2
3: 13
4: 195
Right 989960655 5:50410671-50410693 ATTGAGGAATAGAAGCAGGAAGG 0: 2
1: 0
2: 2
3: 38
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989960655 Original CRISPR ATTGAGGAATAGAAGCAGGA AGG Intronic
900993480 1:6108361-6108383 ATGGAGGAATGGAAGGACGAAGG + Intronic
901988424 1:13093293-13093315 ATTGAGCAATAGAATGGGGAAGG + Intergenic
901993388 1:13133474-13133496 ATTGAGCAATAGAATGGGGAAGG - Intergenic
902476104 1:16688709-16688731 ATTGAGGAAGACAAGGAGAAGGG - Intergenic
902662651 1:17915907-17915929 ATTGAGCAAGGGAAGCAGAACGG - Intergenic
902731958 1:18375580-18375602 AGTGAGGAAGAGAGGCAGGGAGG + Intronic
902780965 1:18704860-18704882 ATTGAGGCATAGAAAGGGGAAGG - Intronic
903453336 1:23470136-23470158 ACTGAGGCATAGAAGGAGGAAGG - Intronic
905318421 1:37098268-37098290 ATTAGGGAAGAGAGGCAGGATGG - Intergenic
906234138 1:44193586-44193608 GTTGATGAACAGAAGCAGAAGGG + Intergenic
906300208 1:44675991-44676013 ATTGAGGATTGGGAGAAGGAGGG + Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906640936 1:47439867-47439889 TTTGAGAAATAAAAGCAGGGGGG + Exonic
906784882 1:48606548-48606570 ACTGAGGAACAGAGGCAAGAAGG - Intronic
906797919 1:48712207-48712229 TTTGTGGAACAGAAGAAGGAAGG - Intronic
907222158 1:52914974-52914996 TTTGAGGAAAAGAAGGGGGAAGG - Intronic
908539958 1:65112869-65112891 ATTGAGAAGTAGGACCAGGATGG + Intergenic
909025758 1:70480022-70480044 ATTGAAGAAAAGAAGGAGGAAGG - Intergenic
909180413 1:72416782-72416804 AATGAGGAATGGAGGAAGGAAGG - Intergenic
909828916 1:80160683-80160705 CTTGGGGATTAGAAGCAAGATGG + Intergenic
910258126 1:85269717-85269739 AGTGAGGAACAGAGGCAGGAGGG + Intronic
910367004 1:86476532-86476554 ATGGAAGAATACAAGCAGTAAGG + Exonic
911317561 1:96373782-96373804 ACTGGGGAATAGAAGTAGTAAGG + Intergenic
911715579 1:101128828-101128850 AAAGAGGGAAAGAAGCAGGAAGG + Intergenic
912282804 1:108334505-108334527 CTTGAGGAAGAAAGGCAGGATGG + Intergenic
912925336 1:113907814-113907836 ATTGAAAAATAGGAGTAGGATGG + Intronic
913717912 1:121557203-121557225 ATTGAGGAATAGAAGCAGGAAGG - Intergenic
914357827 1:146902967-146902989 ATAGAGGAAAAGCAGGAGGAAGG - Intergenic
914510878 1:148330794-148330816 AATAAACAATAGAAGCAGGAAGG + Intergenic
915842652 1:159228042-159228064 ATAGAGGAAGAGAAAGAGGAGGG - Intergenic
916015796 1:160748919-160748941 ATTGATAAATAGATGCAAGAAGG + Intronic
916599937 1:166282987-166283009 TTTGAGGAAGGGAAACAGGAGGG - Intergenic
917060853 1:171037215-171037237 AATGAGGAAGAAAAGGAGGAAGG + Intronic
917408303 1:174732752-174732774 TTTGAGGAAAATAACCAGGAAGG - Intronic
917965688 1:180177108-180177130 ATTGAGAAATAGAAGCAGCAAGG - Intronic
918301497 1:183208136-183208158 AAGGAGGAAAAGAAGAAGGAAGG + Intronic
919186814 1:194161642-194161664 ATTCAGGAAAAGAAACAGGTTGG + Intergenic
919305246 1:195824307-195824329 ATTGAGGAATTGATAGAGGATGG - Intergenic
920089548 1:203442511-203442533 AGAGAGGAATAGAAGGAGGAAGG - Intergenic
924715130 1:246566288-246566310 AGTGAGGGAGAAAAGCAGGAAGG - Exonic
1063721558 10:8587202-8587224 AATGAGGAAGTGAAGAAGGAAGG - Intergenic
1063954411 10:11252990-11253012 ATAGAGGATTAAAAGCTGGATGG - Intronic
1064177670 10:13089508-13089530 AGTGAGGAAAAGTATCAGGAAGG - Intronic
1065182362 10:23139394-23139416 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1065901387 10:30211143-30211165 CTTGGAGAATAGAAGCAAGATGG + Intergenic
1066473635 10:35723650-35723672 ATACAGGAATAGAATCAAGAAGG + Intergenic
1066529028 10:36316119-36316141 ATTGAGGAGAATAAGGAGGAGGG - Intergenic
1067251861 10:44593358-44593380 AGGGAGGGAAAGAAGCAGGAAGG + Intergenic
1068602840 10:58973903-58973925 ATTTAAGTATAGAATCAGGAAGG + Intergenic
1070480083 10:76873738-76873760 ATTGAGGAATAAAGGTAGGAAGG - Intronic
1071264700 10:83954647-83954669 AACGAGGAAGAGAAGCAGGAAGG - Intergenic
1073662645 10:105493861-105493883 ATGGAGGGAAAGAAGAAGGAAGG + Intergenic
1074589297 10:114797608-114797630 ATAGAGGAATAAAATAAGGAAGG - Intergenic
1077321745 11:1946005-1946027 ATGAAGGCATTGAAGCAGGATGG - Intergenic
1077810432 11:5631059-5631081 ATCGAGGAATAGAAATAGCAAGG - Intronic
1078675435 11:13408218-13408240 AATGATGAACAGAACCAGGATGG - Intronic
1078754858 11:14199639-14199661 ACAGAGGAATTTAAGCAGGAGGG - Intronic
1078766187 11:14300771-14300793 AAGGAGGAAAAGAAGAAGGAAGG + Intronic
1080415223 11:32063686-32063708 ATGGAGGAATGGAAGGATGAAGG - Intronic
1081064417 11:38523141-38523163 AGTGAGGAAGACAGGCAGGAGGG - Intergenic
1081781830 11:45718428-45718450 AATGAGGAGTAGAAGGAGGCAGG - Intergenic
1082979337 11:59105552-59105574 ATGGAGGATTTGAAGCAGGGGGG - Intergenic
1083079874 11:60080177-60080199 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1084667819 11:70585921-70585943 ATGGAGGAATGGATGAAGGATGG - Intronic
1084697479 11:70764316-70764338 ATAGATGGATAGAAGGAGGAGGG - Intronic
1085019211 11:73194709-73194731 ACGGAGGAAGGGAAGCAGGAAGG + Intergenic
1085477395 11:76796933-76796955 AGTGGGGAAGGGAAGCAGGAGGG - Exonic
1085816064 11:79738796-79738818 GTGGAGGAAGAGAAGGAGGATGG + Intergenic
1087821412 11:102716981-102717003 ATTGGGGAATAGAGGCAGTTAGG + Intronic
1088723731 11:112616804-112616826 CCTGAGGAATAGAAGCAGCATGG + Intergenic
1088758936 11:112911267-112911289 ATTAATGTAGAGAAGCAGGATGG - Intergenic
1090378703 11:126309915-126309937 GTTGAGAAAAAGAAGAAGGAAGG - Intronic
1091198293 11:133750378-133750400 ATTGAAGACCAGAGGCAGGAAGG + Intergenic
1202804763 11_KI270721v1_random:1318-1340 ATGAAGGCATTGAAGCAGGATGG - Intergenic
1092053535 12:5490534-5490556 AGTGGGGAATGGAAACAGGAAGG - Intronic
1092463688 12:8709449-8709471 ATTGAGGGGCAGAAGCAGGCAGG + Intronic
1092931039 12:13316019-13316041 ATAAAGGAATAAAAGCAAGATGG - Intergenic
1092991149 12:13900799-13900821 ATAGAGTAAAAGAAGCAAGAGGG - Intronic
1093241794 12:16685973-16685995 ATTGAGGAAGGGAAGGAGGAGGG - Intergenic
1095585729 12:43847337-43847359 TTTGAGGTATAGAAACAGGAAGG + Intronic
1095633847 12:44408195-44408217 ATGTAGTAATAGAAGCAGCAAGG - Intergenic
1096491950 12:52017637-52017659 TTTGAGGAATAGGAGCAGAAGGG - Intergenic
1096777577 12:53973641-53973663 ACTGAGGAGTAGAAGCCGGCGGG - Exonic
1097098755 12:56571252-56571274 ATGGAGGAAGAGCAGGAGGAGGG - Intronic
1097939999 12:65293801-65293823 AGTGAGGAATAAATGCAGCATGG + Intronic
1098401444 12:70080866-70080888 ATTGAGAAACAGCAGCAGGGAGG + Intergenic
1099473296 12:83076773-83076795 AGGGAGAATTAGAAGCAGGAGGG - Intronic
1100161346 12:91864632-91864654 ATTGAGCAAAAGAAGCAGCAAGG + Intergenic
1101181575 12:102224384-102224406 ATTGTGGAGAAAAAGCAGGATGG + Intergenic
1101616693 12:106344881-106344903 ATTGAGGCAGTGATGCAGGAAGG + Intronic
1101659659 12:106754526-106754548 AATGAGGAAGTGAAGAAGGAGGG - Intronic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1102552781 12:113703805-113703827 AGTGAGGGAAAGAGGCAGGAGGG - Intergenic
1102747196 12:115259441-115259463 ATTGTGGCATGGAGGCAGGAAGG + Intergenic
1102966935 12:117135151-117135173 ATTCAGGAGCAGAGGCAGGAGGG - Intergenic
1103177604 12:118878133-118878155 ATTGAGGCAGAGAAGCAGAGAGG + Intergenic
1103388490 12:120552784-120552806 ATTGTGGGAAAGAAGCAGAAAGG + Intronic
1104779297 12:131409610-131409632 ATGGAGGAATAGATGAATGATGG - Intergenic
1105551323 13:21398601-21398623 ACTGAGGTATAGAATCAGGGTGG - Intronic
1106131928 13:26948199-26948221 AATGAGGCAGAGAAGCGGGAGGG + Intergenic
1106625673 13:31418642-31418664 ATGCAGTAATAGAACCAGGAAGG - Intergenic
1106794359 13:33189346-33189368 AGTCAGGAAAAGAAGCAGGAGGG + Intronic
1107493842 13:40905307-40905329 ATTGTGGAATAGGATCAGGTTGG - Intergenic
1107706041 13:43106316-43106338 ATTGAGGACTAGAAGTTAGAAGG + Intronic
1108800835 13:54092720-54092742 AGTGAGGAATAGCAGGAGCAGGG + Intergenic
1108952122 13:56107454-56107476 ATTTAGGAATAGGAACAGAAGGG - Intergenic
1110102396 13:71625563-71625585 GTTGAGGAATAGAAGAACTAAGG + Intronic
1110717967 13:78729689-78729711 CTGGAGTAATAGAAGCTGGAGGG - Intergenic
1111695442 13:91617659-91617681 ATTGAGGAATGGAAGGAAGGAGG - Intronic
1111823957 13:93245329-93245351 AGAGAAGAATAGAAGAAGGAAGG - Intronic
1111956121 13:94760478-94760500 AAAGAGGAAGAGAAGGAGGAAGG - Intergenic
1112488747 13:99843105-99843127 AGTGAGGACTTGAAGCAGGATGG + Intronic
1112828715 13:103422510-103422532 ATTGAGGAATAAAAACGTGAAGG + Intergenic
1112949477 13:104974932-104974954 ATTAAGGAAAAGAAGTAGGCTGG - Intergenic
1113797978 13:113069808-113069830 CTAGAGGGAGAGAAGCAGGAAGG + Intronic
1115387905 14:32819412-32819434 ACTGAGGAATACAAGCATCATGG + Intronic
1115667330 14:35565873-35565895 TTTAAGGAATAGAATCATGATGG + Intronic
1115728582 14:36243570-36243592 ATTGAGGAATAGACTTTGGAGGG + Intergenic
1115952990 14:38742469-38742491 GTTGAGGAGGAAAAGCAGGAAGG + Intergenic
1116242217 14:42359441-42359463 ATTGAGGAAGAGAGACAAGAGGG - Intergenic
1116695064 14:48164496-48164518 AATGAGGAATAGAAGAAAAAAGG + Intergenic
1118496297 14:66311119-66311141 CTTGAGAAAAAGAACCAGGAAGG + Intergenic
1118947964 14:70406334-70406356 ATTGGAGATTAGAAGCAAGATGG - Intronic
1121272414 14:92646833-92646855 ATTAAGGAAAAGAAACTGGAAGG - Intronic
1121642582 14:95495716-95495738 AATGAGGAAGTGAATCAGGAAGG + Intergenic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121919087 14:97863930-97863952 ACTGAGGAGGAGAATCAGGATGG + Intergenic
1121936038 14:98019832-98019854 CTTGAGGAGAAGCAGCAGGATGG - Intergenic
1122342479 14:101037432-101037454 ATTGAGGAATAGCTGCTGGCTGG - Intergenic
1202940873 14_KI270725v1_random:143889-143911 AGGGAAGAATAGAGGCAGGAAGG + Intergenic
1123973314 15:25528863-25528885 ATTGAGGAAAGGAAGCAGGCGGG + Intergenic
1124786523 15:32686563-32686585 AGAGAGGAATAGAGGGAGGAAGG + Intronic
1125780735 15:42264617-42264639 ATTGAGAGATAGAAACAGAATGG + Intronic
1125789341 15:42351587-42351609 ATTCATGAAGAGAAGCAAGATGG - Intronic
1127000120 15:54493372-54493394 AGTGAGGGAGAGAGGCAGGAAGG - Intronic
1127476702 15:59340702-59340724 ATTCAGGAATAAAATCAGGAAGG + Intronic
1127820701 15:62653203-62653225 ATTGAAGAAAAGAAAGAGGAAGG + Exonic
1127912728 15:63431448-63431470 ATTGAGAAATATCAGCTGGAAGG - Intergenic
1128626885 15:69217669-69217691 ATTGGGGTATTGAAGAAGGATGG + Intronic
1129798183 15:78393860-78393882 ATTGAGGAAGGAAAGAAGGAAGG + Intergenic
1129831927 15:78676284-78676306 GTGGAGGAAGAGAAACAGGAGGG + Intronic
1129949377 15:79572434-79572456 ATGGAGGGATGGAAGAAGGAAGG + Intergenic
1130127420 15:81105381-81105403 ATGGAGGAAGGGAAGAAGGAAGG - Intronic
1130439865 15:83942771-83942793 ATTGAAGAATGGCAGCAGGTAGG + Exonic
1130580982 15:85136534-85136556 ACTGATGAAGAGAAGCAGCAGGG + Exonic
1130812210 15:87391821-87391843 ATTGAGGAATGGAAGGCTGAGGG + Intergenic
1131466994 15:92663725-92663747 ATTGTGGAATATACTCAGGACGG - Intronic
1131575675 15:93588280-93588302 AGGGAAGAATAGAAGTAGGAAGG - Intergenic
1131575682 15:93588324-93588346 AGGGAAGAATAGAAGTAGGAAGG - Intergenic
1131796962 15:96029081-96029103 ATTGAGGAAAGGATCCAGGAAGG + Intergenic
1132276288 15:100567496-100567518 ATTTAGGGAAAGAAGCAGGGCGG - Exonic
1133126844 16:3652716-3652738 AGTGGGGACTAGAAACAGGAAGG - Intronic
1133648939 16:7791202-7791224 TTTGTGCAATAGAAGCAGGCTGG - Intergenic
1133711714 16:8408084-8408106 ATGGAGGAATAAAGGAAGGAAGG - Intergenic
1134287978 16:12879120-12879142 ATGGAGGGAGAGAAGGAGGAAGG - Intergenic
1135967069 16:27044645-27044667 CTTGAGGAAGAGGAGGAGGAAGG - Intergenic
1136033634 16:27521382-27521404 ACTGGGGAAGAGAAGCAGGCTGG - Intronic
1137979258 16:53055665-53055687 CTGGAGGAATAGGAGGAGGAGGG - Intronic
1138101302 16:54254299-54254321 ATAGAGAAATAAAGGCAGGAAGG + Intronic
1138784981 16:59835707-59835729 TTTGATGAATAGAGACAGGAAGG - Intergenic
1139153590 16:64414131-64414153 ACTGAGGAATAGATTCAGAAGGG - Intergenic
1139320391 16:66109652-66109674 AATGAGGAAGGGAAGAAGGAAGG + Intergenic
1139540476 16:67611514-67611536 TTTGAGGAAGAACAGCAGGAGGG + Exonic
1139976356 16:70814325-70814347 ATAGAGGAAAAGCAGGAGGAAGG + Intronic
1140618812 16:76701869-76701891 ACTGTGGACTAGAAGCAGGTGGG - Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141056851 16:80824811-80824833 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1141916399 16:87100131-87100153 ATTGTGGAGGACAAGCAGGACGG + Intronic
1142729539 17:1843273-1843295 TTTGAAAAATAGAAGCAGAATGG + Intronic
1143707664 17:8710374-8710396 AGTGAGGTATAGAAACAGCAGGG - Intergenic
1144204159 17:12967447-12967469 GTTGAGGAATTGAGGCAGGAGGG - Intronic
1146282093 17:31551210-31551232 ATTCAGGCATAGAAATAGGAAGG + Intergenic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1149796917 17:59529255-59529277 ATTGAGAAAATGCAGCAGGATGG - Intergenic
1150987074 17:70210850-70210872 AGAGAAGAAGAGAAGCAGGAAGG - Intergenic
1151480813 17:74369225-74369247 AGTGAGGAGAAGAGGCAGGATGG - Intronic
1151484093 17:74387715-74387737 ATAGAGGAACTGAGGCAGGAGGG - Intergenic
1151702272 17:75749884-75749906 CTGGAGGAACAGAAGCGGGAGGG - Intronic
1151788134 17:76286278-76286300 ATTGTGGCATAGACGCAGAATGG + Intronic
1152087721 17:78230959-78230981 TTTGAGGAATATAGTCAGGAAGG - Intergenic
1152370161 17:79882677-79882699 ATTGAGGAGGAGGAGGAGGAGGG - Intergenic
1152434793 17:80269518-80269540 ATGGATGAATAGAAAGAGGATGG - Intronic
1153002597 18:469533-469555 GTTGAGAAATAGAAGCAAGCAGG - Intronic
1153498205 18:5721669-5721691 ATTGTGGAATAGGTCCAGGATGG - Intergenic
1154059619 18:11047314-11047336 ATTCAGGAATAGCAGTGGGATGG + Intronic
1154316265 18:13306174-13306196 AGTAAGGAAGAGAAGCAGCATGG + Intronic
1155408287 18:25513797-25513819 AATCAGGAATAGAAGAAAGAGGG - Intergenic
1157130353 18:45001591-45001613 TTTGAGGAGGAGCAGCAGGAAGG + Intronic
1157191189 18:45583078-45583100 ATTGGAGAAGGGAAGCAGGAAGG + Intronic
1159067726 18:63588568-63588590 GAAGAGGAATAGAAGCAGAAAGG + Intronic
1159672208 18:71235694-71235716 GGTGAGGAATAGAAGGAAGATGG + Intergenic
1159685400 18:71412837-71412859 ATACATGAATAGAAGCAGGGAGG - Intergenic
1160085712 18:75775742-75775764 CTAGAGCAATAGAAACAGGAAGG + Intergenic
1160442400 18:78902580-78902602 AGTGAGGAAAACCAGCAGGAAGG - Intergenic
1161934568 19:7363755-7363777 ATTGATGAAAGGAAGGAGGATGG + Intronic
1162155547 19:8675888-8675910 ATGGAGGAATAGATGGTGGATGG + Intergenic
1162203314 19:9036997-9037019 ATGGATGAATAGAAGATGGATGG + Intergenic
1162549571 19:11351059-11351081 ACTGGGGAATGGAGGCAGGATGG + Intronic
1164588640 19:29494333-29494355 ATGGAGGAAGGGAAGAAGGAAGG + Intergenic
1164771934 19:30816223-30816245 AGGGAGGAAAAGAAGGAGGAAGG - Intergenic
1165290331 19:34878804-34878826 AGTGCAGAATAGAGGCAGGAGGG - Intergenic
1167139209 19:47638089-47638111 AGAGAGGAATAGAGGGAGGAGGG - Intronic
1167233822 19:48301970-48301992 ATGGAGGTATAGAACCTGGATGG + Intronic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
1168103079 19:54151397-54151419 AGTGGGGTTTAGAAGCAGGACGG + Intronic
1202710123 1_KI270714v1_random:14562-14584 ATTGAGGAAGACAAGGAGAAGGG - Intergenic
925443333 2:3907122-3907144 AGGGAGGAATGGAAGCAGAAGGG - Intergenic
925510020 2:4615143-4615165 CTTGTGGAATATAGGCAGGAAGG - Intergenic
926392197 2:12404824-12404846 AGTGAGGAAGAAAAACAGGAAGG - Intergenic
926412333 2:12617274-12617296 ATTGATGAAGAAAAGAAGGAAGG + Intergenic
928110678 2:28506412-28506434 TTTGAGGAACAGGAGCAGGCTGG + Intronic
928744318 2:34393891-34393913 CTTGAGGTATAGATGCTGGATGG + Intergenic
928953067 2:36832100-36832122 ACTCAGGGATATAAGCAGGAAGG + Intergenic
929178016 2:39001614-39001636 ATTTAGGAAAAGAATCTGGAAGG + Intronic
929455272 2:42060722-42060744 ATTGAGGAAGCAATGCAGGAGGG + Intergenic
929915805 2:46134466-46134488 ATTGAAGAATGCAAGCAGCAGGG + Intronic
930068465 2:47346001-47346023 AGAGAGGAACAGAAGCAGGTAGG - Intronic
930764694 2:55073000-55073022 ATTGAGGGATGGAAGCTAGAAGG - Intronic
931326103 2:61225546-61225568 ATAGAGGAATAAAAACAGGGTGG - Intronic
931896772 2:66740409-66740431 GTTGAGGAATAGAAGGAAGAGGG + Intergenic
932489131 2:72107877-72107899 ATTCAGAAAAAGAAACAGGAAGG - Intergenic
933291421 2:80442507-80442529 ATTAAGGAACAAAAGCAAGATGG - Intronic
934735311 2:96687083-96687105 AGGGAGGATTAGAAGCAGGGAGG - Intergenic
935200872 2:100855550-100855572 ATTGTGGAATAAATGCATGATGG - Intronic
936364622 2:111841601-111841623 ATTAAGAAATAAGAGCAGGAAGG + Intronic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938394105 2:130929348-130929370 ATGGAGGAAGAGAAACTGGATGG - Intronic
939861543 2:147426950-147426972 AAAGAGGAGTAGAAACAGGAAGG + Intergenic
941457352 2:165725090-165725112 ATTGAGAAAAAGAAGGAGGGAGG + Intergenic
941521335 2:166548004-166548026 AATGAAGAATAGAGGCAAGAAGG - Intergenic
941622379 2:167792829-167792851 ATTCAGGAACAAAAGCAAGATGG + Intergenic
941862124 2:170293686-170293708 ATAGAGAAAGAGAAGCAGTAGGG + Intronic
942246510 2:174013231-174013253 AGAGAGGGAGAGAAGCAGGACGG - Intergenic
943770119 2:191707105-191707127 AATGAGAAATGGAAGCATGATGG + Intergenic
943857605 2:192818286-192818308 ATGGTGGCATAGAAGCAAGATGG + Intergenic
943937700 2:193943352-193943374 AAAGAGGAATAGAAGGAGGCAGG + Intergenic
944959205 2:204851201-204851223 ACTGAGGAATAAAAGCAGAAAGG - Intronic
945743707 2:213694717-213694739 AGAGAGGAATGCAAGCAGGAAGG - Intronic
945988449 2:216372542-216372564 ATTTAGGAAGGGAAGGAGGAGGG + Intergenic
946139232 2:217674353-217674375 ATTGAGGAAGGAAAGTAGGAAGG + Intronic
946550202 2:220792983-220793005 AATGAAGAAAAGAAACAGGAAGG - Intergenic
947382495 2:229558859-229558881 GCTGAGGCAGAGAAGCAGGAGGG + Intronic
947433252 2:230049459-230049481 AGTGAGGAATAGGAAAAGGAAGG - Intronic
947536473 2:230942961-230942983 CTAGGGGAACAGAAGCAGGATGG - Intronic
948443243 2:238011357-238011379 AATGATGAATTGAAGGAGGAGGG - Intronic
948892035 2:240912096-240912118 AGAGAGGAAAAGAAGCGGGAGGG - Intergenic
1169547514 20:6665695-6665717 AGGGAGGAAGAGAGGCAGGAAGG - Intergenic
1170485174 20:16808182-16808204 ATCCAAGAACAGAAGCAGGATGG - Intergenic
1170894597 20:20402174-20402196 GTTGAGGAATGGAGGCAGGCTGG - Intronic
1170922082 20:20688629-20688651 ACTGAGGTATAGAAGTAGGAGGG - Intronic
1170940684 20:20845654-20845676 AAGGAGGAACAGAAGCAGAAAGG + Intergenic
1172740722 20:37164366-37164388 AGAGAGGAAGAGAAGGAGGAGGG - Intronic
1173388426 20:42609677-42609699 CTAGAGGAAGAGAAGCTGGAAGG - Intronic
1173614374 20:44393217-44393239 ATTCAGGAACATAAACAGGAGGG + Intronic
1174275508 20:49400967-49400989 ATGGATGAATAGAAGAAGGAAGG - Intronic
1174570684 20:51499043-51499065 AGTGAGGAAGAGAGGCAGGCAGG + Intronic
1175004380 20:55666695-55666717 ATTGAGTAATAGAACCATGTGGG + Intergenic
1175558859 20:59899578-59899600 ATGTAGTAATAGAAGCAGAAAGG + Intronic
1175687983 20:61045213-61045235 ATGGATGAATAGACGGAGGATGG - Intergenic
1175839549 20:62018504-62018526 AGAGAGGAGTAGAGGCAGGAGGG - Intronic
1175870521 20:62207394-62207416 ATTGAGCAAGAGCACCAGGAGGG - Intergenic
1175983974 20:62755157-62755179 GTGGAGGGATAGAAGGAGGAAGG - Intronic
1177180386 21:17738694-17738716 ATTGAAGAACAGAAGATGGAAGG + Intergenic
1178087731 21:29129337-29129359 ATTCAGGAAGAGAAAAAGGAAGG - Intronic
1179623628 21:42634577-42634599 ATGGAGGAATAGGAGGATGATGG - Intergenic
1180628905 22:17213648-17213670 AATGAGGAGGAGAAGCAGCACGG + Intronic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1181161716 22:20963706-20963728 ATGGAGGGCTGGAAGCAGGAGGG - Intergenic
1184555919 22:45233076-45233098 ACTGAGGCTCAGAAGCAGGAGGG - Intronic
949693843 3:6670980-6671002 ATACAGGAAAAGAAGAAGGAAGG + Intergenic
949739356 3:7212587-7212609 ATACAGGAAGAGAAGAAGGAAGG + Intronic
950311202 3:11959504-11959526 ATTAAGGAAAAGAAGGAGAATGG - Intergenic
950572899 3:13813030-13813052 TTAGAGGAACAGAAGGAGGAGGG + Intergenic
950635783 3:14313506-14313528 ATTGAGGAGGAGAGGAAGGAAGG - Intergenic
950932169 3:16800905-16800927 AGTGAGGAAGAGAAGGAGGAAGG + Intergenic
953120571 3:40037380-40037402 ATTTAGGAATAGAGGGAGGCAGG + Intronic
953190174 3:40678585-40678607 ATTGGGAAAAGGAAGCAGGATGG - Intergenic
953721954 3:45363919-45363941 GAGGAGGAATAGAAGAAGGAGGG - Intergenic
953799414 3:46010910-46010932 CTTGAAGATTAGAAGCAAGATGG - Intergenic
954759369 3:52862873-52862895 ATGGAGGAATAGAGACAGAAGGG + Intronic
955036348 3:55271821-55271843 AAGGAGGAAGGGAAGCAGGAAGG + Intergenic
955743320 3:62115414-62115436 GTTGAGGAGTATAAGCAGGTAGG + Intronic
956084329 3:65594051-65594073 ATTCAAGAATAAAAACAGGATGG - Intronic
956840240 3:73133318-73133340 ATTGAGGAAAAGGAGAAAGAAGG - Intergenic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
958492821 3:94799211-94799233 TTTGAGAAGTTGAAGCAGGAGGG - Intergenic
958906969 3:99952514-99952536 ATTGTGGAATAGAAGCCACAAGG + Intronic
960465342 3:117990915-117990937 ATTGAGGAATAGCTGAAGGAAGG - Intergenic
960659709 3:120044215-120044237 ATTGAGAGATGGAAGCTGGATGG - Intronic
961153738 3:124661569-124661591 ATTGATGAACAAAAACAGGAAGG + Intronic
961289845 3:125837628-125837650 AGTGATGAATCTAAGCAGGAAGG - Intergenic
961550713 3:127669245-127669267 TTTGAGGAACAGAGACAGGAGGG - Intronic
961634741 3:128326092-128326114 GTTGAGGGATAGAAGCATGAGGG + Intronic
961897261 3:130178379-130178401 AGTGATGAATCTAAGCAGGAAGG + Intergenic
963097999 3:141566038-141566060 ATTTAAAAATAGAAGGAGGAAGG - Intronic
963325271 3:143855616-143855638 ATGTAGGGATAGAAGCAGAAGGG + Intergenic
963861137 3:150311696-150311718 AGTGGGGAATAGAAGAAAGAAGG + Intergenic
963936555 3:151059908-151059930 ATTGTGGTATAAAAGCTGGAAGG - Intergenic
964415658 3:156444967-156444989 ATTGAGTAAAAGAAGAAGAAAGG + Intronic
964703608 3:159595266-159595288 ATCAAGGAATTGGAGCAGGAGGG + Intronic
964793328 3:160473033-160473055 ATTGAGAGGTAGGAGCAGGAAGG - Intronic
964892247 3:161551278-161551300 ATTCAGGAAGAAAAGAAGGAAGG + Intergenic
965581938 3:170277910-170277932 ATGGAGGAACAGACGTAGGAAGG - Intronic
966031948 3:175360453-175360475 ATTTAGGAAAAGAAGCAAGAGGG - Intronic
966299117 3:178459116-178459138 ATTCAGGAATAGAGGCACTAGGG - Intronic
966964482 3:184976622-184976644 ACTGGGGAATATAAGAAGGAAGG - Intronic
967291710 3:187927126-187927148 ATTTAGAAATAGAACCAGAATGG + Intergenic
967691568 3:192479979-192480001 ATTGAGAAAGAGAAGAAAGAAGG + Intronic
968083171 3:195861099-195861121 ATTGATTAATAGAAACAGGCAGG + Intergenic
968748276 4:2372387-2372409 GCTGAGGACTAGAAGGAGGATGG - Intronic
970224542 4:13844054-13844076 AATGAGGAAGAGAGGAAGGAAGG - Intergenic
970652496 4:18193941-18193963 TTGGAGAAATATAAGCAGGATGG + Intergenic
970754654 4:19410808-19410830 TTTGGGGAAAAGAAGGAGGAAGG + Intergenic
971066569 4:23039380-23039402 ATTAAAGACTAGAGGCAGGAAGG + Intergenic
971688211 4:29798721-29798743 ATTGGAAAATAGAAGTAGGAAGG - Intergenic
971778411 4:30998371-30998393 GTTGAGGAATGGAGGGAGGAAGG + Intronic
972838899 4:42908149-42908171 AGTGAGCAATACAAACAGGAAGG - Intronic
973077542 4:45948127-45948149 ATGGAGGAAGAGAAGCAGTGTGG - Intergenic
973251950 4:48069750-48069772 ACTGAGACATAGAAGGAGGAAGG - Intronic
973893815 4:55393252-55393274 AATGAGGACTAGAAGGATGATGG + Intergenic
974096186 4:57367098-57367120 ATTGAGGTATGGAAGCATGGAGG - Intergenic
974494712 4:62611631-62611653 GTAGAGGAATAGAAGCAGTAAGG + Intergenic
975319537 4:72994742-72994764 AGGGAGGAAGAGAAGGAGGAGGG - Intergenic
975817466 4:78233996-78234018 ATTGTGGAATAGAGGGAGGGTGG - Intronic
976771612 4:88659189-88659211 TTTGCTGAATAAAAGCAGGAAGG - Intronic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
977376585 4:96212703-96212725 ATTGAAGAAAAGAAAGAGGAAGG + Intergenic
979188335 4:117826840-117826862 ATAGGGGAACAGAAACAGGAAGG + Intergenic
979289723 4:118966269-118966291 ATTGAGGTATAGGAGCCAGAGGG - Intronic
979552867 4:122010621-122010643 ATGGAGGGATAGAAACTGGAGGG - Intergenic
979769289 4:124502838-124502860 AAAGAGGAAGAAAAGCAGGATGG - Intergenic
979877084 4:125906181-125906203 ATTTAGCAATTGAAGCATGAGGG - Intergenic
980434417 4:132749965-132749987 GTTGATGAGTAGAAGCTGGAAGG - Intergenic
980620428 4:135294361-135294383 ATGGAGGCATAGAAGCAAGCTGG - Intergenic
981214357 4:142147026-142147048 ATGTAGGAAGAGAAGCACGAAGG - Intronic
981616086 4:146646469-146646491 AGGGAGGAAGAGAAGGAGGAAGG - Intergenic
981917000 4:150045239-150045261 GGTGAGGAATGGAAGCAGAAAGG + Intergenic
982501267 4:156159324-156159346 ATTGGGGTATAGCAGCAGGCTGG + Intergenic
984129536 4:175856675-175856697 ACTGAGCGATGGAAGCAGGATGG + Intronic
984534235 4:180953500-180953522 GTTGATGAATAGAAGCAAGTAGG - Intergenic
984799677 4:183702680-183702702 ATGGGGGGATACAAGCAGGAAGG + Intronic
985052023 4:186000544-186000566 ATGGAGGAAAAGAAGATGGAAGG - Intergenic
986015235 5:3751789-3751811 ATAGAGGAAGAGAGGAAGGAAGG + Intergenic
986221225 5:5770628-5770650 AGTAAGGCAGAGAAGCAGGAGGG + Intergenic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
988649203 5:33129898-33129920 ACTGATGAATGGAAGCAGAAAGG + Intergenic
988679947 5:33475054-33475076 ATTGAGGAAGAGAAACAAAAGGG - Intergenic
989237049 5:39160128-39160150 ATTGAGTAATAAAAACTGGAAGG - Intronic
989751513 5:44899951-44899973 AATGAGGAAGAAAAGAAGGATGG + Intergenic
989960655 5:50410671-50410693 ATTGAGGAATAGAAGCAGGAAGG + Intronic
990184216 5:53195736-53195758 AGGGAAGAGTAGAAGCAGGAAGG + Intergenic
990417447 5:55599648-55599670 CTTCAGGAATAGGAACAGGAAGG + Intergenic
990654453 5:57939635-57939657 AAAGAGGAAGAGAAGAAGGAAGG - Intergenic
991092866 5:62709986-62710008 AGTGAGGAAGAGAGGGAGGAAGG - Intergenic
991537415 5:67686182-67686204 ATGGAGGAAGTGAAGCAAGATGG - Intergenic
991646788 5:68808300-68808322 AAGGAGGAAGAGAGGCAGGAAGG + Intergenic
993241079 5:85385933-85385955 ATTGTGGCATAGAAGCAGGCTGG - Intergenic
994127829 5:96189421-96189443 ATTGAGGAATAAAGACAAGAGGG - Intergenic
994164290 5:96592675-96592697 TTGGAACAATAGAAGCAGGAAGG - Intronic
994721962 5:103390820-103390842 ATTGTGGAGTAGAAAGAGGAAGG - Intergenic
995329013 5:110925868-110925890 GTTGAGGATCAGAAGTAGGATGG - Intergenic
996798433 5:127376361-127376383 ATTGCGGAATAGAGGCAACAAGG + Intronic
998568362 5:143235864-143235886 ATGGAGGAAGAGCAGCAGCAGGG - Intergenic
998589251 5:143460096-143460118 ACTGAGGAAGAAAAGAAGGAAGG + Intergenic
998697622 5:144658029-144658051 ATTGAGGGAGGGAAGAAGGAAGG - Intergenic
999516129 5:152303531-152303553 CTTGAGGAATAGAAGCATAGAGG + Intergenic
999812529 5:155141297-155141319 ATTGTTGATTGGAAGCAGGAAGG + Intergenic
1000466416 5:161583482-161583504 CTTTAGTAATAGCAGCAGGAGGG + Intronic
1000662978 5:163959143-163959165 ATGGAGGAAGAGAAGAAGGAAGG - Intergenic
1001060943 5:168487953-168487975 ATTTGGGAATAAAAGCAGGTTGG + Intronic
1001319558 5:170669028-170669050 GATGAGAAAGAGAAGCAGGAGGG - Intronic
1001918590 5:175582516-175582538 ATTGAGGAAATGAAGGATGATGG - Intergenic
1002023291 5:176379554-176379576 ATTAAGAAATATAACCAGGATGG - Exonic
1002620757 5:180486497-180486519 AAAGAGGAATAGAAGCAGCAAGG - Intergenic
1004751297 6:18565444-18565466 ATGGAGGAAGAAAAGGAGGAAGG - Intergenic
1005087567 6:22022541-22022563 AAAGAGGCAGAGAAGCAGGAAGG - Intergenic
1008106703 6:47446433-47446455 AAAGAGGAATAGAAGAAGGCTGG + Intergenic
1008366087 6:50682293-50682315 AAGGAGGAAGAGAAGCAGGGAGG - Intergenic
1008459452 6:51751180-51751202 ATTCAGGAAGAGAAGAATGATGG + Intronic
1009043109 6:58205288-58205310 ATGGAAGAACAGCAGCAGGAGGG - Intergenic
1009218946 6:60959537-60959559 ATGGAAGAACAGCAGCAGGAGGG - Intergenic
1009671177 6:66753099-66753121 AAGGAGGAAGAGAGGCAGGAAGG + Intergenic
1009902678 6:69828117-69828139 TTTCAGGATTATAAGCAGGAAGG + Intergenic
1011824559 6:91290730-91290752 ATTGATGAATAGCAGCACAATGG + Intergenic
1012289078 6:97428715-97428737 ATGTAGGAATAAAAGCAGGCTGG + Intergenic
1013699609 6:112749319-112749341 ATTGAGGACTAGAAGAATTAGGG + Intergenic
1014491355 6:122065575-122065597 ATGGAGGAAGGGAAGTAGGAAGG + Intergenic
1015383709 6:132598858-132598880 AGAGAGGAAGAGAAGAAGGATGG + Intergenic
1015399121 6:132768593-132768615 ATTGGGGAATAGGAGCAAAACGG - Intergenic
1015841685 6:137483875-137483897 ATAGAGGAATAGAGGAAGAAAGG + Intergenic
1015973787 6:138769031-138769053 ATAGAAGAATGGAAACAGGAAGG - Intronic
1016028640 6:139314787-139314809 CTTGAGGATTAGAAGCAAGATGG - Intergenic
1016696354 6:147000653-147000675 AAAGAGAAATGGAAGCAGGAAGG + Intergenic
1018012675 6:159685966-159685988 ATGGAGGCGTAGAAGAAGGAGGG - Intronic
1018940309 6:168305099-168305121 ATTGAGGAAGAGAGAGAGGATGG + Intronic
1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG + Intergenic
1019529067 7:1494674-1494696 ATTGTGGAGGAGGAGCAGGATGG + Intronic
1022521328 7:31009035-31009057 ATGGGGGGAGAGAAGCAGGAGGG - Intergenic
1022590268 7:31654700-31654722 AATGGGGAATAGATGCAGAATGG + Intronic
1022996164 7:35757544-35757566 ATTGAGGAAAAGGAGAAGAAAGG - Intergenic
1026501322 7:70945535-70945557 GATGAGGAATAGACCCAGGAAGG - Intergenic
1026513499 7:71047120-71047142 ATTGAGGAATAGAGACACCACGG + Intergenic
1026636041 7:72082492-72082514 TTTGAGGACTAGAAACAGAATGG + Intronic
1026903473 7:74049625-74049647 ATGGAGGAATAGATGGTGGATGG - Intronic
1027353651 7:77336381-77336403 ATTGAGGAACAGACCCAGGATGG - Intronic
1030060997 7:105621219-105621241 ATTGACAAAAAGAAGAAGGAAGG - Intronic
1030120740 7:106108439-106108461 AGACAGGGATAGAAGCAGGAGGG - Intronic
1032499411 7:132388846-132388868 TTTGAGGAATAGAATAATGAAGG - Intronic
1033336677 7:140459605-140459627 AAAAAGGAATAGAAGCAGAAAGG + Intronic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1033959777 7:146900364-146900386 GGTCAGGACTAGAAGCAGGAAGG - Intronic
1034135440 7:148763517-148763539 TTTGAGGAACAGAAGCATTAAGG - Intronic
1036497591 8:9283409-9283431 AATGAGGAATGAAAGAAGGAAGG - Intergenic
1036538695 8:9680024-9680046 ATTAAGGAAGAGAAGGAGGAGGG + Intronic
1037764610 8:21764705-21764727 ATTGAAGGATGTAAGCAGGAAGG - Intronic
1038682591 8:29683090-29683112 ACTGAGGCATGGAAGCTGGAAGG - Intergenic
1039744092 8:40408164-40408186 ATTGAGGAATAGCAGGTGGCTGG - Intergenic
1040889443 8:52301811-52301833 AATGAGGAAAAAAAGGAGGAAGG - Intronic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041538443 8:58955372-58955394 AGAAAGGAATAAAAGCAGGAAGG + Intronic
1041970059 8:63730256-63730278 ACTGAGGACTAGAAGAAGGGAGG + Intergenic
1042353519 8:67801690-67801712 GTAGGAGAATAGAAGCAGGAAGG + Intergenic
1043527864 8:81115659-81115681 ATTTAGGGATGGAAGAAGGAAGG + Intergenic
1044954758 8:97468407-97468429 TTTGAGGAACAGAAGAAGCAGGG - Intergenic
1045372255 8:101536031-101536053 ATTTAGACAGAGAAGCAGGAAGG + Intronic
1045554932 8:103206774-103206796 AGGGAGGGAGAGAAGCAGGATGG + Intronic
1046137194 8:110043376-110043398 AATGAGGAAGAAAAGCAGAAAGG + Intergenic
1046256327 8:111700823-111700845 AATGTGGCATACAAGCAGGAAGG + Intergenic
1046421167 8:113984717-113984739 ATTGAGCAGGAGGAGCAGGAGGG + Intergenic
1046969066 8:120200878-120200900 AATAAGGAAAAGAAACAGGAGGG - Intronic
1047545069 8:125808149-125808171 ATGGAGGAATGCTAGCAGGAAGG + Intergenic
1047650714 8:126917101-126917123 AATGAGGAATAGAGGGAGTAAGG - Intergenic
1047731475 8:127732422-127732444 ATTGAGAAATAGAAAAAGAAAGG - Intergenic
1047806465 8:128366220-128366242 ATTGAGGAAGTGATGCTGGAAGG - Intergenic
1048593110 8:135839869-135839891 ATTGAAGAAGAAAAGAAGGAAGG - Intergenic
1049321206 8:141997455-141997477 CCTGAGGAATAGAACCAGGAAGG - Intergenic
1049350698 8:142163007-142163029 ATTGATGTATAGATGGAGGATGG + Intergenic
1049479617 8:142815654-142815676 AAAGAGGGAAAGAAGCAGGATGG - Intergenic
1050225444 9:3449442-3449464 AATGAGGAAAAGAACCAGGCAGG - Intronic
1050729227 9:8689027-8689049 ATTATGGATTAGAAGCAGGATGG + Intronic
1050740716 9:8816791-8816813 CTTTAGGAATAGAAGAAGAAAGG + Intronic
1051696336 9:19771914-19771936 ATTGGGGGATAGAAGGTGGATGG + Intronic
1051989389 9:23133151-23133173 AGTGAGGGAGAGAAGAAGGAAGG + Intergenic
1052395684 9:27935233-27935255 AAGGAGGAATAGAAGAAGCAGGG + Intergenic
1053009063 9:34623302-34623324 ATTGAGGTATGGGAGCAGTAAGG - Intronic
1053075436 9:35129541-35129563 TTTGGAGATTAGAAGCAGGATGG + Intergenic
1054935903 9:70687252-70687274 TTTGAGGATGAGGAGCAGGAAGG + Intronic
1056412630 9:86346411-86346433 AATGAGGAAAATGAGCAGGATGG - Exonic
1056968782 9:91185779-91185801 CTTTAGGCAAAGAAGCAGGAAGG - Intergenic
1057003688 9:91536467-91536489 ATTGAGGGGTAGAAGCACTATGG + Intergenic
1057422136 9:94920971-94920993 GGTGGGGAATAGAAGCAAGAGGG + Intronic
1057497721 9:95574134-95574156 ACAGAGAAAGAGAAGCAGGAAGG - Intergenic
1057831404 9:98409841-98409863 TTTCAGGAACAGAAGCTGGAAGG - Intronic
1058401059 9:104619821-104619843 AATGAGCAATAGAACCAGCATGG - Intergenic
1058727872 9:107820611-107820633 AGAAAGGAAAAGAAGCAGGAGGG + Intergenic
1058931339 9:109722388-109722410 ACTGAGGAATAGGAGTGGGAGGG + Intronic
1059037937 9:110779268-110779290 ATTGAGAAATAAATTCAGGAGGG - Intronic
1059253260 9:112906185-112906207 ATTAAAGGTTAGAAGCAGGATGG - Intergenic
1060498125 9:124132857-124132879 AGTGAGGACCAGGAGCAGGAGGG + Intergenic
1185603702 X:1355266-1355288 ATGGAGGAAGAGGAGCAGGAGGG + Intronic
1185636733 X:1557611-1557633 ATGGATGAATAGAAGATGGATGG - Intergenic
1185683861 X:1910922-1910944 AGAGAGGAAGAGAGGCAGGAAGG - Intergenic
1185683888 X:1911093-1911115 AGAGAGGAAGAGAGGCAGGAAGG - Intergenic
1185683928 X:1911350-1911372 AGAGAGGAAGAGAGGCAGGAAGG - Intergenic
1186239999 X:7555444-7555466 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1186624001 X:11272477-11272499 AATGAGGAGTGGAGGCAGGAGGG - Intronic
1186849780 X:13569376-13569398 GTTGAGAAGTCGAAGCAGGATGG - Intergenic
1187841589 X:23494357-23494379 CTTGAAGGTTAGAAGCAGGATGG + Intergenic
1190257897 X:48777589-48777611 ATGAAGGAATAGAAGAAGGAAGG + Intergenic
1190461980 X:50685690-50685712 ATTGAGGATTAGAATGAGAAAGG - Intronic
1191883301 X:65863652-65863674 ATTGAGGTTTAGAAAGAGGATGG - Intergenic
1193043414 X:77027356-77027378 ATTGAGGTAGAGATGCAGGGAGG - Intergenic
1193435320 X:81468276-81468298 ACCAAGGAGTAGAAGCAGGATGG - Intergenic
1193753610 X:85379088-85379110 ATAGAGGCAAAGAAGCAGAAAGG + Intronic
1195394032 X:104391852-104391874 AGTGGGGAAGAGAAGCAGGAGGG + Intergenic
1196141102 X:112264674-112264696 AATGAGGAAGAGAAGGAAGATGG - Intergenic
1196406009 X:115363116-115363138 TTTGAGACATAGAAGCAGCATGG - Intergenic
1197616691 X:128699912-128699934 ATGGAGGAAGAGAAGAAGGGAGG + Intergenic
1198015600 X:132607206-132607228 ACTGAGGAATAGAAGCAGGGAGG - Intergenic
1198197674 X:134381143-134381165 ACTGAGGAATAGTGGCAGAAGGG + Intronic
1198229169 X:134673274-134673296 ATGGAGGAAGGGAAGAAGGAAGG + Intronic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199599960 X:149535919-149535941 GTGGAGGAATAGGAGCTGGAAGG - Intergenic
1199650680 X:149944332-149944354 GTGGAGGAATAGGAGCTGGAGGG + Intergenic
1199774192 X:150996524-150996546 AGTGAGGAGCAGAAGCAGGTTGG + Intergenic
1199849414 X:151714794-151714816 AAGGAGGAAAAGAAGAAGGAAGG - Intergenic
1200254892 X:154575394-154575416 ACCGAGGAAGAGAGGCAGGAAGG - Intergenic
1200262877 X:154629014-154629036 ACCGAGGAAGAGAGGCAGGAAGG + Intergenic
1201696201 Y:16829142-16829164 ATTGAGGGACAGAGGAAGGAAGG + Intergenic
1202377428 Y:24250290-24250312 ACTGAGGAAAAGGAGCAGGCTGG + Intergenic
1202493352 Y:25419831-25419853 ACTGAGGAAAAGGAGCAGGCTGG - Intergenic