ID: 989977763

View in Genome Browser
Species Human (GRCh38)
Location 5:50607395-50607417
Sequence CTGTTAACAAAGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989977757_989977763 18 Left 989977757 5:50607354-50607376 CCCTAAAGGAAAAGACAAATTAA No data
Right 989977763 5:50607395-50607417 CTGTTAACAAAGAAGGAAGAGGG No data
989977758_989977763 17 Left 989977758 5:50607355-50607377 CCTAAAGGAAAAGACAAATTAAA No data
Right 989977763 5:50607395-50607417 CTGTTAACAAAGAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989977763 Original CRISPR CTGTTAACAAAGAAGGAAGA GGG Intergenic
No off target data available for this crispr