ID: 989983098

View in Genome Browser
Species Human (GRCh38)
Location 5:50666613-50666635
Sequence CCGCGGGCGCGAGTGTGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 6, 3: 10, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989983090_989983098 -2 Left 989983090 5:50666592-50666614 CCTGGGCACGGCTGCCGCCGCCC No data
Right 989983098 5:50666613-50666635 CCGCGGGCGCGAGTGTGCGCGGG 0: 1
1: 0
2: 6
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989983098 Original CRISPR CCGCGGGCGCGAGTGTGCGC GGG Intronic