ID: 989983098 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:50666613-50666635 |
Sequence | CCGCGGGCGCGAGTGTGCGC GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 106 | |||
Summary | {0: 1, 1: 0, 2: 6, 3: 10, 4: 89} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
989983090_989983098 | -2 | Left | 989983090 | 5:50666592-50666614 | CCTGGGCACGGCTGCCGCCGCCC | No data | ||
Right | 989983098 | 5:50666613-50666635 | CCGCGGGCGCGAGTGTGCGCGGG | 0: 1 1: 0 2: 6 3: 10 4: 89 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
989983098 | Original CRISPR | CCGCGGGCGCGAGTGTGCGC GGG | Intronic | ||