ID: 989986853

View in Genome Browser
Species Human (GRCh38)
Location 5:50711055-50711077
Sequence GGTGAATTGTTTGTTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989986850_989986853 11 Left 989986850 5:50711021-50711043 CCTCAGCATATATTAGTGTGTTT 0: 1
1: 0
2: 3
3: 24
4: 231
Right 989986853 5:50711055-50711077 GGTGAATTGTTTGTTGCTACTGG 0: 1
1: 0
2: 1
3: 8
4: 109
989986849_989986853 16 Left 989986849 5:50711016-50711038 CCTAGCCTCAGCATATATTAGTG 0: 1
1: 0
2: 1
3: 5
4: 134
Right 989986853 5:50711055-50711077 GGTGAATTGTTTGTTGCTACTGG 0: 1
1: 0
2: 1
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989986853 Original CRISPR GGTGAATTGTTTGTTGCTAC TGG Intronic
903097999 1:20998591-20998613 GGTGAATTGTTTGATCCTAGAGG - Intronic
904015009 1:27412931-27412953 GCTGAATTGTTTGTAGTAACAGG + Intronic
904303014 1:29568162-29568184 GCTGAAATGGTTGTTGCTGCAGG - Intergenic
907498936 1:54864498-54864520 GATGAATTGGTGGTTGCCACAGG + Intronic
908205307 1:61841997-61842019 AGTGGATTGATTGTGGCTACTGG + Intronic
910835285 1:91501930-91501952 AGTGAATTGTATGTTTCTATAGG + Intronic
918189930 1:182164157-182164179 GGGGAATTGTTGGTTGCCATGGG - Intergenic
918421688 1:184370664-184370686 AGTGAATTTTTTTTTACTACAGG - Intergenic
919558225 1:199087830-199087852 GGTGAATTCTTTGTTGTAAGGGG - Intergenic
921745308 1:218733628-218733650 GGTGAAACGTTTGCTGCTGCTGG - Intergenic
921933577 1:220775580-220775602 GGTAAATTGTGTGTTGCTGAGGG + Intronic
922198874 1:223384042-223384064 CGTGAAATGTTTGTTTCTATGGG - Intergenic
1070367785 10:75752812-75752834 GTTTAAGGGTTTGTTGCTACTGG + Intronic
1071541204 10:86485799-86485821 GCAGAATTGTTTTTTCCTACTGG - Intronic
1074014924 10:109525034-109525056 TGTGAATTGGTTGTTGCTTAAGG + Intergenic
1079979683 11:27136597-27136619 GGTGTAGTTTTTGTTGCTATTGG - Intergenic
1081224374 11:40501941-40501963 GGTGACTTGGGTGTTGCTAAAGG - Intronic
1093300006 12:17442534-17442556 GGTGACTTGGTTGCTGCTAAAGG + Intergenic
1098652797 12:72994166-72994188 AGTGAGTTGTTTGTCCCTACTGG + Intergenic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1100645242 12:96522629-96522651 CGGGTGTTGTTTGTTGCTACTGG - Intronic
1102664859 12:114563174-114563196 GGGGAATTGTATGTTGCCACAGG - Intergenic
1102711923 12:114935712-114935734 GGATAATTCTTTGTTGCTAGGGG + Intergenic
1103227438 12:119300278-119300300 AGTGGATTGTTTGTTTCTATGGG - Intergenic
1104510682 12:129374924-129374946 GGTGAAATATTTCTAGCTACAGG + Intronic
1106199076 13:27521143-27521165 AGTAAATTAGTTGTTGCTACGGG + Intergenic
1107196274 13:37656194-37656216 GGAGAATTGTTTGTTTCAAAGGG + Intronic
1109098180 13:58144506-58144528 GGTGACTTGTATGCTGCTAAAGG + Intergenic
1110000343 13:70190287-70190309 GGTTAATTGTTTGTGGCAAAAGG - Intergenic
1110395856 13:75028925-75028947 GGTGAATTGGTTGCTGTTAAAGG + Intergenic
1110460500 13:75739724-75739746 GGTGAATTTTCTATTGCTGCTGG - Intronic
1111357285 13:87124862-87124884 GGAGAATTCTTTATTGCTCCGGG + Intergenic
1114323257 14:21564665-21564687 GGTGAGTTCATTCTTGCTACAGG + Intergenic
1116281616 14:42915275-42915297 GGTGACTTGTGTGTTGTTAAAGG - Intergenic
1118431965 14:65727833-65727855 GGTGACTTGGTTGCTGCTAAAGG - Intronic
1127411602 15:58713103-58713125 GGTGTTTTGTTTGTTGAGACAGG + Intronic
1130640027 15:85663953-85663975 CGAGAATTGTTAGTTGCAACAGG - Intronic
1130728955 15:86469922-86469944 GGTTACTTGTTTCTTGCTATTGG + Intronic
1134386288 16:13776467-13776489 GTTGATTTGTTTATTTCTACAGG + Intergenic
1135832114 16:25784406-25784428 GGTTAATTGTTTGGTGCAAGAGG - Intronic
1139203191 16:65000270-65000292 GGTGAGGAGTTTTTTGCTACAGG - Intronic
1140570469 16:76100132-76100154 AGTAAAATGTTGGTTGCTACAGG - Intergenic
1142485046 17:241888-241910 GGTGAATTGTTTGAGGCCAAGGG + Intronic
1143380777 17:6494931-6494953 GGTGAGTTGTTTTTTGCAATGGG - Intronic
1144068959 17:11650185-11650207 GGTCAATTCTTTATTGCTAGTGG - Intronic
1146651185 17:34607394-34607416 AGAGATTTGTTTGTTGCTGCAGG - Intronic
1154967011 18:21369130-21369152 GGCGAATTGTTTTTTGCCTCTGG + Intronic
1159443081 18:68506754-68506776 GGTGAAATGTATATTGCTAAAGG + Intergenic
1162899073 19:13783596-13783618 GGTGTATTGTTTATAGCTAAGGG - Intergenic
1167719285 19:51167679-51167701 GTTGAGTTGTTTGTGGCCACTGG - Intergenic
928357686 2:30634920-30634942 GCTCAGTTGTTTGTTGGTACTGG + Intronic
929474591 2:42233279-42233301 GATAAATTGTTTGTTATTACAGG + Intronic
930442938 2:51431926-51431948 GGTGACTTGTGTGTTGTTAAAGG + Intergenic
937188257 2:120066965-120066987 ATTGAATTGTTTTTTGCTACTGG + Intronic
943194041 2:184719527-184719549 GGTGACTTGCTTGTTGTTAAAGG - Intronic
944556052 2:200888886-200888908 GCTGAGTTCTGTGTTGCTACTGG - Intronic
1169438684 20:5615811-5615833 GGTGAAAATTTTGCTGCTACTGG + Intergenic
1173116370 20:40247470-40247492 GGAGAATTGTTTGTCTCTGCCGG - Intergenic
1175453405 20:59090219-59090241 GGGTAATTGTTTATTGGTACAGG - Intergenic
1177504423 21:22001522-22001544 GGTGATTTGTGTGCTGCTAAAGG - Intergenic
949614871 3:5742296-5742318 GGTGTAATGTTTGTTGCTGCTGG - Intergenic
953890004 3:46744440-46744462 GGTGCAGTCTTTGTTGCTAGGGG + Intronic
959781394 3:110238547-110238569 GGAGAATTGTTTGTTGGTGTTGG - Intergenic
962009298 3:131378683-131378705 GTTGGTGTGTTTGTTGCTACTGG + Intergenic
965968975 3:174530114-174530136 GGTGACTTGTGTGTTGTTAAAGG - Intronic
967339658 3:188382256-188382278 TGTGAATTGTGTGTTTGTACAGG + Intronic
969125757 4:4946634-4946656 AGTGACTTGTTTATTGCCACAGG + Intergenic
970105884 4:12583645-12583667 GGTGAATTGATTTTTGATAAAGG + Intergenic
971661895 4:29429291-29429313 GGTGAATTGTCTATAGCTAGTGG + Intergenic
975808188 4:78135355-78135377 CATGAATTATTTATTGCTACTGG + Intronic
980541621 4:134202753-134202775 CGTGGCTTGTTTGTGGCTACTGG - Intergenic
982263650 4:153518561-153518583 TGTGATGTGTTTGGTGCTACAGG + Intronic
987520551 5:18977017-18977039 CGTGGTGTGTTTGTTGCTACTGG - Intergenic
988828386 5:34963713-34963735 TGTGAATGGTCTGTTGCTGCAGG + Intergenic
989986853 5:50711055-50711077 GGTGAATTGTTTGTTGCTACTGG + Intronic
992279629 5:75161432-75161454 GGTGACTTGTGTGCTGCTAAAGG + Intronic
992669045 5:79040262-79040284 GGAGAATTGGTTGTTGGTGCTGG + Intronic
1000193451 5:158935985-158936007 GTTGAATTATGTGATGCTACTGG + Intronic
1004463411 6:15860791-15860813 TGTGAATGGTTTGTTGCTCTTGG - Intergenic
1004857194 6:19763312-19763334 GGTTAATTGTTTGGTACTAAAGG - Intergenic
1005277333 6:24233555-24233577 GTTTAATTGTTTGACGCTACTGG + Intronic
1007048851 6:38804998-38805020 GGTCAATTCTTTGTTGCTGGGGG - Intronic
1008179320 6:48308697-48308719 GGAGAATGTTTTGTTGCTCCTGG - Intergenic
1008956977 6:57226419-57226441 AGTGAATTGTTTGCTGCCTCAGG - Intergenic
1012078101 6:94720181-94720203 GGTAAATTGTGTGTTGCCAGCGG - Intergenic
1012216124 6:96586651-96586673 TGTGAATGGTTTGCTGCTGCAGG - Intronic
1013652008 6:112204955-112204977 GGTGAAATGTTAGTTGATATTGG + Intronic
1015180114 6:130352458-130352480 GGAGAATTGTTGGTTACTAATGG - Intronic
1020837997 7:13178384-13178406 GGTCAAATATTTGTAGCTACTGG + Intergenic
1020983571 7:15103281-15103303 TGTGAATTGTATGTTATTACTGG - Intergenic
1021443861 7:20711623-20711645 AGTTAATTGTTTGTAGATACAGG + Intronic
1023413921 7:39914681-39914703 GGTGAATTTTTTGTTTTTAGTGG - Intergenic
1023877668 7:44296681-44296703 GGTGAAGTGTTTTTTGCTTCTGG - Intronic
1028231309 7:88309466-88309488 GGTGACTTGTTAGTTGTTAATGG + Intergenic
1029885431 7:103865038-103865060 GGAGAATTGTTTGTTGAACCTGG + Intronic
1031879033 7:127175588-127175610 GGTAAAGTGTTTGTTCCTTCTGG - Intronic
1033593154 7:142831625-142831647 GGTCAAGTGATTGTTGCTGCTGG - Intergenic
1036417912 8:8567377-8567399 GCAGAAATGTTTGTTCCTACAGG - Intergenic
1040319859 8:46287047-46287069 GGTGCATTGTATGTTGCAGCGGG - Intergenic
1041245729 8:55886569-55886591 GGTAAAATGTTTCTTGCTATGGG - Intronic
1042499296 8:69491284-69491306 GGTGAATTGTTTTATGATATGGG - Intronic
1042759775 8:72257791-72257813 GGTGACTTTTTTGTTGATGCTGG - Intergenic
1043579587 8:81697025-81697047 TGTGAATGGTCTGCTGCTACGGG - Intergenic
1044911018 8:97058723-97058745 GGTCAAGTGTTTCATGCTACTGG - Intronic
1046308972 8:112409047-112409069 GGTGATTTGTTTGCTTCTCCGGG - Intronic
1048561096 8:135538326-135538348 GCTGAACTGTTTGTTTCCACTGG - Intronic
1053387022 9:37700523-37700545 GGTGAATTCTTTGTTGTTACAGG + Intronic
1056329613 9:85510732-85510754 GGTGACTTGTATGTTGCCACTGG - Intergenic
1061661801 9:132135276-132135298 AGTGAATTTTTTGTAGCGACAGG - Intergenic
1186958599 X:14710216-14710238 GGTGAGTTGTTTGTTTCTGCAGG - Intronic
1186970904 X:14841388-14841410 GTTGAAGTTTTTGTTTCTACTGG + Intergenic
1190844487 X:54179564-54179586 AGTGACTTTTTTGTTGTTACTGG - Intronic
1193443477 X:81570314-81570336 GGTGAATTTTTTTTTGAGACAGG - Intergenic
1193940006 X:87670895-87670917 GGAGAATTGTCTGTGTCTACTGG - Intergenic
1196129986 X:112145014-112145036 GATGAATGGCTTATTGCTACAGG - Intergenic
1197672877 X:129298207-129298229 GGTGAATTTTTTGTAGAGACAGG - Intergenic
1197965421 X:132055734-132055756 AGGGAAGTGTTTGTTGTTACTGG + Intergenic
1199239782 X:145532903-145532925 GGTAAATTGTGTGTTGCTAGGGG - Intergenic
1202090654 Y:21185179-21185201 GCTGCATTGTTTGAGGCTACAGG - Intergenic