ID: 989986885

View in Genome Browser
Species Human (GRCh38)
Location 5:50711398-50711420
Sequence TCCCCTAACTGATTGATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989986878_989986885 0 Left 989986878 5:50711375-50711397 CCTCTGGCCTGCCTTCTCCCTCC 0: 1
1: 2
2: 6
3: 140
4: 1219
Right 989986885 5:50711398-50711420 TCCCCTAACTGATTGATTCAGGG 0: 1
1: 0
2: 2
3: 6
4: 116
989986879_989986885 -7 Left 989986879 5:50711382-50711404 CCTGCCTTCTCCCTCCTCCCCTA 0: 1
1: 0
2: 10
3: 173
4: 1643
Right 989986885 5:50711398-50711420 TCCCCTAACTGATTGATTCAGGG 0: 1
1: 0
2: 2
3: 6
4: 116
989986877_989986885 1 Left 989986877 5:50711374-50711396 CCCTCTGGCCTGCCTTCTCCCTC 0: 1
1: 3
2: 11
3: 120
4: 1064
Right 989986885 5:50711398-50711420 TCCCCTAACTGATTGATTCAGGG 0: 1
1: 0
2: 2
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989986885 Original CRISPR TCCCCTAACTGATTGATTCA GGG Intronic