ID: 989986996

View in Genome Browser
Species Human (GRCh38)
Location 5:50712760-50712782
Sequence ATATGGATCTGGTGGTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989986992_989986996 9 Left 989986992 5:50712728-50712750 CCACGGGAGCATGCAGGGTGAGA 0: 1
1: 0
2: 0
3: 8
4: 135
Right 989986996 5:50712760-50712782 ATATGGATCTGGTGGTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989986996 Original CRISPR ATATGGATCTGGTGGTCAGA AGG Intronic
No off target data available for this crispr