ID: 989987017

View in Genome Browser
Species Human (GRCh38)
Location 5:50713136-50713158
Sequence ATCTATATGTTATAGATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989987014_989987017 5 Left 989987014 5:50713108-50713130 CCCCATTTATAAAATGGCTGTGA 0: 1
1: 1
2: 10
3: 130
4: 1067
Right 989987017 5:50713136-50713158 ATCTATATGTTATAGATCTGTGG 0: 1
1: 0
2: 2
3: 15
4: 243
989987016_989987017 3 Left 989987016 5:50713110-50713132 CCATTTATAAAATGGCTGTGAGA 0: 1
1: 0
2: 3
3: 25
4: 323
Right 989987017 5:50713136-50713158 ATCTATATGTTATAGATCTGTGG 0: 1
1: 0
2: 2
3: 15
4: 243
989987015_989987017 4 Left 989987015 5:50713109-50713131 CCCATTTATAAAATGGCTGTGAG 0: 1
1: 0
2: 1
3: 30
4: 300
Right 989987017 5:50713136-50713158 ATCTATATGTTATAGATCTGTGG 0: 1
1: 0
2: 2
3: 15
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989987017 Original CRISPR ATCTATATGTTATAGATCTG TGG Intronic
901165384 1:7217427-7217449 AACTATATGTTATATATAAGAGG - Intronic
905815144 1:40944266-40944288 ATATATATGGTATATATATGCGG - Intergenic
907590490 1:55662881-55662903 ATATGTATGTTATATATATGGGG + Intergenic
907590515 1:55663188-55663210 ATATATATGTTATATGTCTATGG + Intergenic
907771126 1:57465071-57465093 ATCTGTATGTTAAAAAGCTGAGG - Intronic
908718238 1:67093881-67093903 ATATATTTGTTAAATATCTGGGG + Intronic
909743143 1:79057606-79057628 ATGTATATATAATAGAACTGTGG + Intergenic
910046002 1:82917448-82917470 ATCTATATGTGTAAAATCTGTGG - Intergenic
910641087 1:89462796-89462818 ATCTGTATTTTATGGATTTGAGG - Intergenic
911095524 1:94051756-94051778 CTCTAGATCTTATAGAACTGCGG - Intronic
916763020 1:167833924-167833946 ATTTATCTGTTATATATCTTAGG - Intronic
918096255 1:181337018-181337040 ATCTATATTTTATATATTTAAGG + Intergenic
919411060 1:197243638-197243660 ATGTATATTTTATTGATTTGGGG + Intergenic
919433307 1:197524378-197524400 ATCAATATTTTATAGATCTGAGG + Intronic
919589183 1:199478986-199479008 AATTATATGTTACAGATCTGTGG - Intergenic
924536175 1:244937590-244937612 ATCTATAGATTCTAGAACTGGGG - Intergenic
1063853980 10:10225817-10225839 AGTTATTTGTTATACATCTGTGG - Intergenic
1064707687 10:18090111-18090133 TTCTATATGTTTAAGATCTGAGG + Intergenic
1064834954 10:19516362-19516384 GTCTATATGTTATGTATGTGTGG - Intronic
1064848022 10:19677966-19677988 ATCAATTGGTTGTAGATCTGTGG + Intronic
1066527874 10:36300879-36300901 TTGTATATGTTATAGAAATGGGG - Intergenic
1070223678 10:74477738-74477760 ATATAAATGTTATAAATCTCGGG - Intronic
1071917500 10:90311322-90311344 ATCTATGTGTTCTAGATGTTTGG + Intergenic
1071971666 10:90914189-90914211 ATCAATAGGTTATTGATCTTTGG + Intronic
1073807149 10:107109953-107109975 ATCTATGTCCTAAAGATCTGTGG - Intronic
1075384663 10:122046980-122047002 ATCTATAAATTATAAATCTTTGG - Intronic
1075431572 10:122387531-122387553 ATTTATATGGTATATACCTGAGG + Intronic
1077428419 11:2499287-2499309 TGCCATATGTTTTAGATCTGAGG - Intronic
1084311750 11:68320766-68320788 ATCTTTTTCTTATAGATTTGTGG + Intronic
1086059503 11:82685764-82685786 ATTTATTTCTTATAGTTCTGGGG + Intergenic
1086530737 11:87781919-87781941 ATGTATATTCTATTGATCTGGGG - Intergenic
1086731189 11:90251605-90251627 ATCTATGTATAATATATCTGAGG + Intergenic
1087140698 11:94762918-94762940 ATCGTTAAGTTATAGATCTGAGG - Intronic
1087333859 11:96817964-96817986 ATCTAAATGCTATTGATTTGGGG + Intergenic
1088437506 11:109831573-109831595 ATCTATATCTTATACCTCTAAGG - Intergenic
1091442805 12:524698-524720 ATCTAGATGTTGTAGTTCTTGGG + Intronic
1091942802 12:4504239-4504261 ATCTACATGTCAAAGATCTGGGG + Intronic
1092456437 12:8647729-8647751 ATCTGTCTGATATAGATCTTAGG - Exonic
1092967466 12:13658234-13658256 ATCTTTATATTATAAATGTGTGG - Intronic
1093474805 12:19543185-19543207 ATGAATATGTTATATATTTGAGG - Intronic
1093675865 12:21939926-21939948 ATGTATATGTTCTAGATGTGTGG - Intronic
1095371922 12:41477982-41478004 ATCTACATGATATAGATAAGAGG + Intronic
1095658745 12:44702925-44702947 AAGCATATGTCATAGATCTGTGG - Intronic
1097280110 12:57840029-57840051 TACTGTATGTTAAAGATCTGTGG - Intronic
1098202839 12:68075132-68075154 ATCTAGATATTACATATCTGAGG + Intergenic
1099456955 12:82875380-82875402 ATATATATGTTTTACAGCTGAGG + Intronic
1099468546 12:83018000-83018022 ATATATATATTATATATATGAGG - Intronic
1099577635 12:84401750-84401772 ATATATATCTTATAGGACTGTGG + Intergenic
1099923765 12:88992093-88992115 ATTTATATTATATAGATATGTGG + Intergenic
1099985296 12:89655464-89655486 ATTTATATGTTTTAGATTGGCGG - Intronic
1100062330 12:90595591-90595613 AACTATATGTTAGAAACCTGTGG - Intergenic
1100124363 12:91405851-91405873 ATCTACATGCCATAGACCTGAGG - Intergenic
1100213157 12:92419149-92419171 ATATATATATTATAGAGATGGGG + Intergenic
1100933255 12:99634419-99634441 ATATATTTTTTATAGTTCTGAGG - Intronic
1101442909 12:104716859-104716881 ATTTATATCTTATGGTTCTGGGG + Intronic
1101636690 12:106549372-106549394 ATGTATATTTTATTGATTTGGGG + Intronic
1105262805 13:18792200-18792222 ATCCAAATGTGATAGATGTGGGG - Intergenic
1105719007 13:23095402-23095424 ATTTATTTCTTATAGTTCTGGGG - Intergenic
1106162001 13:27209929-27209951 ATCTCTATGTTTTAGAGGTGGGG - Intergenic
1106904764 13:34393476-34393498 AGCTAAATGTTATAGGTGTGAGG - Intergenic
1107721106 13:43248830-43248852 ATATATATGTTATATGTATGTGG - Intronic
1111428595 13:88123056-88123078 AACTATATTATATAGATATGGGG - Intergenic
1112397748 13:99048609-99048631 ATCTGTATGTTACAGTTATGGGG - Intronic
1116717364 14:48444753-48444775 ATGTATATGCTGTTGATCTGGGG - Intergenic
1117666265 14:58059495-58059517 ATCTATATTCTCTAGATCTTGGG - Intronic
1117915489 14:60673662-60673684 ATATATATGTTTTAGAGATGGGG - Intergenic
1118125524 14:62898959-62898981 ATTTATATTTTATATATTTGAGG - Intronic
1119101334 14:71882832-71882854 ATCTATATGATATAGTTTTTTGG - Intergenic
1125977954 15:43972494-43972516 TTCTATATCTAGTAGATCTGGGG + Intronic
1128464071 15:67893969-67893991 ATATATATGTGAGAGATATGAGG - Intergenic
1130748172 15:86678741-86678763 ATCTATCTGTTATTGAACTGAGG + Intronic
1133505122 16:6404114-6404136 ATATATATTTTTTCGATCTGTGG - Intronic
1135433100 16:22403868-22403890 ATATATATGTTGTAGAGATGAGG + Intronic
1136041291 16:27581052-27581074 ATATATATGTTTTAGAGATGGGG - Intronic
1138890313 16:61135182-61135204 ATATATATGGTATATATATGTGG - Intergenic
1139005159 16:62560848-62560870 ATCTGTATGCAATAGAACTGAGG + Intergenic
1139315930 16:66068746-66068768 ATCTAAAAGCTATACATCTGGGG - Intergenic
1143465991 17:7137069-7137091 AACTCCATGTAATAGATCTGGGG - Intergenic
1143473144 17:7188797-7188819 ATCTCTATGGGAAAGATCTGAGG - Intergenic
1146385352 17:32367105-32367127 GTCTACATGTTTTAGATGTGTGG + Intronic
1146758764 17:35456836-35456858 ATATATATGTTATATATATTAGG + Intergenic
1149153838 17:53602189-53602211 ATATATATGGTATATATATGTGG + Intergenic
1149797083 17:59530546-59530568 ATCCACATGTTAGAGGTCTGAGG + Intergenic
1149893779 17:60413237-60413259 ATCCCTGTGTTATAGAACTGGGG + Intronic
1153424801 18:4950683-4950705 ATCTATTTCTTACAGTTCTGAGG - Intergenic
1154510764 18:15099233-15099255 ATCTATAGGCTATAGATATGTGG + Intergenic
1155339761 18:24802097-24802119 ATCTGCATGTTTTACATCTGGGG - Intergenic
1155720979 18:29011676-29011698 ATCTACATGTAATAGGTCTATGG + Intergenic
1155786413 18:29907382-29907404 ATCTATGAGTTACACATCTGTGG - Intergenic
1159389645 18:67773255-67773277 ATCTATATCTTAAAGATTTCTGG - Intergenic
1162188425 19:8925473-8925495 ATATATATGTTTTATATATGTGG + Intronic
1164980829 19:32613048-32613070 ATTTATATATTCTAGATATGTGG - Intronic
928599905 2:32894414-32894436 ATCTATATTTTATAATTCTGGGG - Intergenic
928751610 2:34476996-34477018 ATCTATATTTTATAAATCCATGG + Intergenic
929067621 2:37995483-37995505 ATTTTTATTTTATAGTTCTGAGG - Intronic
930323589 2:49884856-49884878 ATCTATATTCTGTAGATTTGGGG - Intergenic
930886004 2:56327677-56327699 ATCTCTATGTTAAGGAACTGGGG - Intronic
931280761 2:60789660-60789682 ATGTATCTGTTATAAATTTGGGG + Intronic
931303962 2:61009961-61009983 ATATCTATATTATAGATCTTAGG - Intronic
931539261 2:63311305-63311327 ATCTATAGGCTATAGACCTCTGG + Intronic
932010600 2:67973876-67973898 ATCTATATGTTTTATTTTTGTGG + Intergenic
932064074 2:68534626-68534648 ATATACATGTTAGAGACCTGAGG - Intronic
933312737 2:80680983-80681005 ATTTTTATGTCTTAGATCTGGGG + Intergenic
933359254 2:81257894-81257916 ATCTATGGGTTCTACATCTGTGG + Intergenic
934635267 2:95981333-95981355 ATATATATTTTATATATATGTGG - Intronic
936543110 2:113368174-113368196 ATGTATTTCTTATAGTTCTGGGG + Intergenic
938505985 2:131883692-131883714 ATCTATAGGCTATAGATATGTGG + Intergenic
940614058 2:156028623-156028645 ATGTATATGTTAAAGATATTTGG + Intergenic
940945972 2:159617623-159617645 ATGTATATTTTATACATATGTGG + Intergenic
942805362 2:179925340-179925362 ATTTATTTCTTATAGTTCTGGGG - Intergenic
943096076 2:183430882-183430904 ATTTATATCTTACAGTTCTGTGG + Intergenic
944611631 2:201414738-201414760 ATCTCTATGTAATATATGTGTGG - Intronic
945308182 2:208280313-208280335 AACTGTATGTTCTAGAACTGGGG + Intronic
946356865 2:219191937-219191959 ATATATATTTTATAGAGATGGGG - Intergenic
946367461 2:219257848-219257870 ATATATATTTTATAGATATGGGG + Intronic
946655897 2:221946641-221946663 ACCTATATGGTGTAGATCAGGGG - Intergenic
947033767 2:225827251-225827273 ATCTATATTCTATTGATTTGGGG - Intergenic
948204330 2:236154840-236154862 ATCCATCTGTAATTGATCTGCGG + Intergenic
948648476 2:239424253-239424275 ATTTATGTGTCATAGTTCTGGGG - Intergenic
1169099880 20:2938144-2938166 ATCTATCTGTTTTAGAGGTGGGG - Intronic
1169549980 20:6692528-6692550 ATTTATATGTGATAGAATTGAGG + Intergenic
1169584369 20:7063643-7063665 ATATATATATTTTTGATCTGTGG + Intergenic
1169723932 20:8709036-8709058 ATGTCTCTGTTATAGATTTGGGG + Intronic
1170067609 20:12331325-12331347 ATCTATTTGTTAAAAACCTGCGG + Intergenic
1170382904 20:15781444-15781466 ATTTATTTCTTATAGTTCTGAGG + Intronic
1170879829 20:20287055-20287077 ATCTATTTTTTATAGAGATGGGG + Intronic
1171088412 20:22261304-22261326 ATCAAAATGTTACAGCTCTGAGG + Intergenic
1172415122 20:34759212-34759234 TTCTATATTTTATAGAGATGGGG + Intronic
1172698517 20:36838420-36838442 TTCTATATGTTGTAGAGATGGGG - Intronic
1176787089 21:13270046-13270068 ATCTATAGGCTATAGATATGTGG - Intergenic
1176892048 21:14329845-14329867 ATGTATATTCTATTGATCTGAGG - Intergenic
1177656420 21:24022160-24022182 ATTTATTTCTTATAGTTCTGGGG - Intergenic
1177986256 21:27978685-27978707 ATCTATAGGCTATAGATATGTGG - Intergenic
1178184403 21:30203571-30203593 AGCAATATTTTCTAGATCTGTGG - Intergenic
1180286099 22:10746112-10746134 ATATATATATTAAAAATCTGGGG + Intergenic
1183448518 22:37876657-37876679 ATCAAGATGTTAATGATCTGAGG - Intronic
950753237 3:15148572-15148594 ATATATATGTTATGAATGTGTGG - Intergenic
950856484 3:16110254-16110276 ATATATATGTGTTAAATCTGTGG - Intergenic
951389109 3:22081284-22081306 AGCTATATAGTATAGAACTGGGG + Intronic
953814640 3:46144479-46144501 ATCTCTATGGTATTGATCTTTGG + Intergenic
954267584 3:49481878-49481900 ATCTATAGGTTCCACATCTGTGG + Intronic
955680124 3:61491597-61491619 ATCTATATGTTAAAGGGTTGAGG - Intergenic
957827255 3:85464195-85464217 ATCTATATTTTATACACATGTGG - Intronic
957915635 3:86684886-86684908 ATTTATATCTTATTGTTCTGAGG - Intergenic
959312999 3:104764479-104764501 ATCAATTTGTTATTTATCTGAGG - Intergenic
959854843 3:111140199-111140221 ATCTTTATGTTCTAGATATTTGG + Intronic
965949944 3:174296811-174296833 ATCCATATGAAATAGATATGGGG - Intergenic
966159161 3:176949886-176949908 ATCTTTATTTTAAAGATCTCTGG - Intergenic
966393586 3:179478005-179478027 ATATATTTCTTATAGTTCTGGGG + Intergenic
971324223 4:25630996-25631018 ATATATATATTTTAGAGCTGGGG + Intergenic
971359606 4:25924597-25924619 ATCTGTATGTTATATATAGGGGG - Intronic
971839442 4:31815015-31815037 ATATATATATTATATATATGGGG + Intergenic
972926502 4:44015371-44015393 ATCTATATTTTATTGATGTTAGG + Intergenic
973298959 4:48559012-48559034 ATCTATATGTGGTAGATCTGTGG - Intronic
976081817 4:81363774-81363796 AACTTTATGTAATAGATATGTGG + Intergenic
978285045 4:107067107-107067129 GCCTATATGTTATAGCTGTGTGG - Intronic
978649936 4:110989916-110989938 ATATATTTATTATAGATATGTGG - Intergenic
979181904 4:117740300-117740322 ATATATATTTTATAGATATATGG - Intergenic
979181905 4:117740326-117740348 ATATATATTTTATAGATATATGG - Intergenic
979181906 4:117740352-117740374 ATATATATTTTATAGATATATGG - Intergenic
979181907 4:117740378-117740400 ATATATATTTTATAGATATATGG - Intergenic
979453585 4:120901400-120901422 AACTCTATGTTTTACATCTGAGG - Intronic
981312185 4:143308046-143308068 ATCTAGGTGTTATAGTTCAGAGG + Intergenic
981858429 4:149324265-149324287 ATCAAATTGTTGTAGATCTGTGG + Intergenic
984025155 4:174534499-174534521 ATTTATAGGTTATAGAAGTGGGG + Intergenic
984180701 4:176479271-176479293 TTCTAAATGTTATAGGTGTGAGG + Intergenic
984853745 4:184175590-184175612 ATCTATATGTTGTGAACCTGTGG + Intronic
986142848 5:5048178-5048200 ATCTCTATTTGATACATCTGAGG - Intergenic
986797762 5:11228798-11228820 ATCTATATGCTATTGATATTTGG + Intronic
987023915 5:13904404-13904426 ATATATATATTATAGATATATGG + Intronic
987248336 5:16073060-16073082 ATCTATGTATTATAGATTTTGGG - Intronic
989222581 5:38985365-38985387 CTCTAAATGTTTTAGAACTGCGG + Intronic
989987017 5:50713136-50713158 ATCTATATGTTATAGATCTGTGG + Intronic
991188945 5:63845855-63845877 ATTTATATTTCATACATCTGTGG - Intergenic
992823939 5:80528913-80528935 ATGTATATTTTGTTGATCTGGGG - Intronic
993388410 5:87287934-87287956 ATATATATGTTATATATATATGG - Intronic
993855457 5:93068703-93068725 TTCTATAAGTTATAGATTTCAGG - Intergenic
994015309 5:94957946-94957968 ATGTATATTCTATTGATCTGGGG - Intronic
995920820 5:117309090-117309112 ATCTATTTCTCATAGTTCTGGGG - Intergenic
995999126 5:118337208-118337230 ATCTATTGGTTGTAGATATGTGG - Intergenic
996221218 5:120935379-120935401 AGATATATGTTATATATGTGAGG + Intergenic
996488294 5:124062503-124062525 ATTTTTATGTTTTAGATATGGGG - Intergenic
998640804 5:144008683-144008705 ATGGATATGTTATAAATATGTGG - Intergenic
1000322264 5:160143876-160143898 GGGTATATGTTATAAATCTGAGG + Intergenic
1000383757 5:160654134-160654156 ATGTATATGTTATAGAGATGGGG + Intronic
1000638727 5:163675421-163675443 ATCTATGTTTTATATATATGAGG + Intergenic
1002930135 6:1628308-1628330 ATCTAGATGGGAGAGATCTGAGG - Intronic
1003326978 6:5099423-5099445 ATCTATATTTTATAGCGATGAGG + Intergenic
1005153934 6:22782393-22782415 TTGTATATGTTATAAATATGTGG + Intergenic
1006285511 6:33091183-33091205 ATATATATGCTATAGATTTTTGG - Intergenic
1007058794 6:38916951-38916973 ATCTAAATGTTACATATCAGTGG + Intronic
1008180694 6:48324809-48324831 ATTTATATCTTATAGATGTATGG + Intergenic
1008266561 6:49434924-49434946 ATGTAAATGATATAGCTCTGAGG + Intronic
1008723131 6:54382570-54382592 ATCTATATCATCTATATCTGTGG - Intronic
1008963967 6:57295812-57295834 AGATATATGTTGTAGAACTGAGG - Intergenic
1009182938 6:60540204-60540226 ATCAGAAGGTTATAGATCTGTGG - Intergenic
1009560133 6:65229922-65229944 ATGTATGTGTCATAGATCTCTGG - Intronic
1009756848 6:67951145-67951167 ATCTATATTCTGTTGATCTGTGG - Intergenic
1010303971 6:74295141-74295163 AAATATGTATTATAGATCTGTGG + Intergenic
1010936388 6:81867450-81867472 TTCTATTTGTCATAGATTTGTGG - Intergenic
1012023506 6:93957987-93958009 ATTTACATGTTATAGATATATGG - Intergenic
1014666767 6:124247494-124247516 ACCAATATCATATAGATCTGAGG - Intronic
1015290109 6:131529630-131529652 ATGTATATTTTGTTGATCTGGGG + Intergenic
1020697395 7:11430644-11430666 ATATATATTTTATAGAGATGAGG + Intronic
1022066105 7:26859086-26859108 ACCTTTATTTTATTGATCTGCGG - Intronic
1022436980 7:30396599-30396621 ATCTTTATGTTATTGTACTGTGG - Intronic
1023389508 7:39695573-39695595 TTCTATTTTTTATAGATATGGGG + Intronic
1023662942 7:42489284-42489306 ATATATATGCTATATATGTGAGG + Intergenic
1024247072 7:47478527-47478549 ATGTAGTTGTTATATATCTGAGG - Intronic
1024955033 7:54909449-54909471 ATGTATATTTTCTAAATCTGGGG - Intergenic
1027696413 7:81416591-81416613 ATCTGTATGTTAGAAATCTTGGG + Intergenic
1028503037 7:91540036-91540058 ACCTGTATGTTATAGCTCTTTGG - Intergenic
1031683027 7:124697769-124697791 ACTTATATGCTATATATCTGGGG + Intergenic
1033686893 7:143648259-143648281 ATCAATTTGTCATAGATTTGAGG + Intronic
1033688841 7:143719057-143719079 ATCAATTTGTCATAGATTTGAGG - Intronic
1033697718 7:143809364-143809386 ATCAATTTGTCATAGATTTGAGG - Intergenic
1034270038 7:149799023-149799045 GTCTGCATGTTATGGATCTGAGG - Intergenic
1034373049 7:150617186-150617208 ATGTATATTCTATAGATTTGGGG + Intergenic
1036060113 8:5307448-5307470 TTCAAAATGTTATTGATCTGTGG - Intergenic
1039622008 8:39006442-39006464 ATCTATATTTGAGAAATCTGAGG + Intronic
1041153984 8:54964565-54964587 ATCTATTTCTTACAGTTCTGGGG - Intergenic
1041408121 8:57523511-57523533 ATATATATATTATATATATGTGG + Intergenic
1041408126 8:57523661-57523683 ATATATATATTATATATATGTGG + Intergenic
1041789620 8:61678599-61678621 ATCTAAATCTTATAAATTTGGGG - Intronic
1041964157 8:63655591-63655613 ATCAATCTTTTATACATCTGAGG + Intergenic
1044194940 8:89364429-89364451 ATCTTTATGACAAAGATCTGTGG - Intergenic
1045352192 8:101352009-101352031 ATCTATAGGTTCTGCATCTGTGG + Intergenic
1049027761 8:140008077-140008099 ATTAATATATTATAGCTCTGTGG - Intronic
1051319123 9:15881050-15881072 ATCTAAATGTCCTAGATATGGGG + Intronic
1051527959 9:18068236-18068258 ATCTGTATGTTATACATCTCTGG + Intergenic
1052161457 9:25265246-25265268 ATATATATATTATATATGTGTGG + Intergenic
1052314902 9:27106336-27106358 ATTTATTTGTTGTATATCTGTGG + Intergenic
1054865147 9:69992561-69992583 ATCTATATGTTCCAAATTTGGGG + Intergenic
1055242785 9:74204173-74204195 CTCTATATTTTAAAGATATGAGG - Intergenic
1055587727 9:77772788-77772810 AAATATATGTTATAGATCAAGGG + Intronic
1056069061 9:82967109-82967131 ACATATATGTAATATATCTGTGG + Intergenic
1058311564 9:103510127-103510149 ATCTTTATTTTTTAGTTCTGGGG - Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1060272478 9:122156010-122156032 ATCTCTGTGTTCTAGTTCTGGGG - Intronic
1185564567 X:1085508-1085530 ATCTATATGCCAGAGAGCTGTGG - Intergenic
1185926987 X:4158142-4158164 AACTATATGATATAGATGTGTGG + Intergenic
1186519874 X:10196297-10196319 CTCTAAATGCTATAGGTCTGTGG - Intronic
1186995025 X:15111630-15111652 ATCTATATTTTATATATTAGGGG + Intergenic
1188119269 X:26284767-26284789 ATGTATATTTTGTTGATCTGGGG + Intergenic
1189619201 X:42817530-42817552 ATCTGTATTTTATTGATTTGAGG + Intergenic
1191119979 X:56893331-56893353 ATGTATATTTTATTGATTTGGGG - Intergenic
1192822911 X:74663342-74663364 ATTTATATGTTCTGGATATGAGG + Intergenic
1192997247 X:76525279-76525301 ATGTATATTTTATTGATTTGGGG + Intergenic
1193739425 X:85200251-85200273 ACATAGATGTTATAGTTCTGGGG - Intergenic
1194715063 X:97278368-97278390 CTCTATATGTTATACATATATGG + Intronic
1196356993 X:114806986-114807008 ATATATATGGTATATATATGTGG - Intronic
1196357023 X:114807309-114807331 ATATATATGGTATAGATATATGG - Intronic
1196357027 X:114807361-114807383 ATATATATGGTATAGATATATGG - Intronic
1197248498 X:124190645-124190667 CTCCAGATGTTATAGAACTGAGG - Intronic
1197516445 X:127436089-127436111 AGATATATGTTACAGAGCTGTGG + Intergenic
1198645232 X:138799525-138799547 ATGTATATTTTGTTGATCTGGGG + Intronic
1199523102 X:148759754-148759776 ATCTATTTATGATAGATCTAGGG - Intronic
1200737612 Y:6816531-6816553 ATGTATATTGTATAGATTTGGGG - Intergenic
1201708271 Y:16960662-16960684 ATCTGATTGTTATAGATGTGTGG - Intergenic
1201756231 Y:17488650-17488672 ATATATATGGTATATATATGTGG + Intergenic
1201845321 Y:18417335-18417357 ATATATATGGTATATATATGTGG - Intergenic