ID: 989987450

View in Genome Browser
Species Human (GRCh38)
Location 5:50717858-50717880
Sequence AGGGAGAGAGAAGTGACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1135
Summary {0: 1, 1: 0, 2: 13, 3: 114, 4: 1007}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989987450 Original CRISPR AGGGAGAGAGAAGTGACTGA TGG Intronic
900964242 1:5946714-5946736 AGGGGGAGGAGAGTGACTGAAGG + Intronic
901364546 1:8734855-8734877 ATTGAGAGAGAAGTGAAGGAAGG - Intronic
901660408 1:10795245-10795267 AAGGAGAGCGTGGTGACTGACGG - Intronic
902005040 1:13225542-13225564 AGGGATGGAGAAGAGACAGAAGG - Intergenic
902024266 1:13371336-13371358 AGGGATGGAGAAGAGACAGAAGG - Intronic
903443735 1:23407475-23407497 AGGAACAGTGAAGTGGCTGAGGG - Intronic
903687035 1:25139414-25139436 CGGGAGTGAGAGGTGACTGAGGG - Intergenic
903751344 1:25623070-25623092 AGGGAAACGGAAGAGACTGAAGG - Intronic
903948772 1:26981420-26981442 AGGGAGCAAGAAGGGAATGAAGG - Intergenic
904030745 1:27532147-27532169 AGGGAGAGGGAAGTGATGGTAGG - Intergenic
904274051 1:29368981-29369003 AGGGAGAGAGAGGTGTTTGGGGG + Intergenic
904300236 1:29549441-29549463 AGGGAAGGAGAAGCCACTGAAGG - Intergenic
904332367 1:29768508-29768530 AGTGAGAGAGAAGATGCTGAAGG + Intergenic
904351179 1:29907768-29907790 ATGGAGGGAGGAGTGAATGAAGG + Intergenic
904457999 1:30658674-30658696 AGGGAAGGAGAAGCCACTGAAGG + Intergenic
904683708 1:32246326-32246348 AGAGAGAGAGAAGGGAGGGAGGG - Intergenic
904725771 1:32546820-32546842 AGGGAGACAGAGGGAACTGAAGG - Intronic
905004073 1:34696290-34696312 CGGGGGAGAGGAGTGGCTGATGG - Intergenic
905285718 1:36879031-36879053 AGGGAGAGAAGAGCCACTGAGGG - Intronic
905803234 1:40859221-40859243 GGGGAGAGAGAAGAGAATCAGGG + Intergenic
905808105 1:40891552-40891574 AGGAAGAGAGAACAAACTGAAGG - Intergenic
905939747 1:41853701-41853723 AGGCTGAGAGGAGTGAGTGAGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
906858750 1:49335902-49335924 AGTGAGAGAGTAGTGTCTGATGG - Intronic
906862119 1:49372731-49372753 AGAGAGAGAGAAGAGAGAGAGGG - Intronic
907123037 1:52024448-52024470 ATGGAGAGAGAAATGAATCAAGG - Intronic
907268940 1:53279295-53279317 TGGGAGAGAGAGGTGTCAGAAGG - Intronic
907359727 1:53904843-53904865 AGGGAGAGAGAAAAGACAGTGGG - Intronic
907925801 1:58954100-58954122 AGGGAGAGATAATTGAATCATGG + Intergenic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
908593668 1:65661088-65661110 AGGCAGAGAGAATTGAATCATGG - Intergenic
908767251 1:67565311-67565333 AGAGAGAGAGAATTGGCTGAAGG + Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910070997 1:83213380-83213402 AGGGAATGAGCAGTGGCTGAGGG + Intergenic
910194096 1:84622700-84622722 AGGCAGAGAGAAGAGCCTGTAGG + Intergenic
910210627 1:84789071-84789093 AGGGGGAGATGATTGACTGATGG + Intergenic
910440112 1:87243044-87243066 AGGGAGAAAGCAGTGCCTAACGG - Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910502032 1:87903354-87903376 AGGGAGAGAGAGCATACTGATGG + Intergenic
910574010 1:88737780-88737802 AAGGAGAGGGAAGTGAGTGCAGG - Intronic
910794138 1:91081038-91081060 AGGGAGAGAGATAAGCCTGATGG + Intergenic
911194065 1:94976082-94976104 ATGGAGACAAATGTGACTGAGGG + Exonic
911323751 1:96444996-96445018 AAGGGGAGAGGAGTGACAGATGG + Intergenic
911401450 1:97379786-97379808 AGTGAGAGACAGGAGACTGAAGG + Intronic
911742349 1:101400809-101400831 AGGGAGAGAGCAGTCCCAGAGGG + Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912628284 1:111224440-111224462 AGAGAGAGAGAAGGGAGTTAGGG + Intronic
913243114 1:116847637-116847659 AGGGAGAGAGAAATGAGGGTTGG + Intergenic
913286399 1:117230674-117230696 TGGCATAGAGAAGTGAATGATGG + Intergenic
913485456 1:119329121-119329143 AGGGAAAGACAAGTTACAGAAGG - Intergenic
913659824 1:120996836-120996858 AGAGAGAGAGAAGTGACTTGTGG + Intergenic
913672577 1:121111500-121111522 AGGGTCAGAGAAGTGAATGTGGG + Intergenic
913694126 1:121307826-121307848 AGAGAGAGTGAAGGAACTGAAGG + Intronic
913705890 1:121422724-121422746 AGGGAAAAAGAAGTGATTCAGGG + Intergenic
914011181 1:143779974-143779996 AGAGAGAGAGAAGTGACTTGTGG + Intergenic
914024346 1:143898865-143898887 AGGGTCAGAGAAGTGAATGTGGG + Intergenic
914143437 1:144972240-144972262 AGAGAGAGTGAAGGAACTGAAGG - Intronic
914166653 1:145181162-145181184 AGAGAGAGAGAAGTGACTTGTGG - Intergenic
914565911 1:148866543-148866565 AGGGAGAGAGGAGGGAGGGAAGG + Intronic
914606914 1:149263705-149263727 AGGGAGAGAGGAGGGAGGGAAGG - Intergenic
914649804 1:149688613-149688635 AGAGAGAGAGAAGTGACTTGTGG + Intergenic
914662828 1:149806886-149806908 AGGGTCAGAGAAGTGAATGTGGG + Intronic
914798908 1:150945511-150945533 AGGGAGAGAGAAGGGAGAAAAGG - Intronic
915595434 1:156893989-156894011 ATGGAGAGAGACGTGAAGGAGGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
915770081 1:158412011-158412033 AGGGAGAAAGAACTGACTCAAGG + Intergenic
915895440 1:159808114-159808136 AGAGGGAGAGAAGTGACTGATGG + Intronic
915920840 1:159974106-159974128 AGAGGGAGAGAAGTGACTGATGG - Intergenic
916098111 1:161369260-161369282 AGGAAAAGAGAAGGGACTGATGG - Exonic
916306327 1:163338179-163338201 AGGGAGATAAAAGAGACTTAAGG - Intronic
916572134 1:166037247-166037269 AGTGAGGGAGAAGTCACTGATGG + Intergenic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
917627810 1:176863582-176863604 AGGGACAGAGATCTGACAGAGGG + Exonic
917635257 1:176929654-176929676 AGGCAGAAAGGAGTTACTGAAGG + Intronic
917871728 1:179248170-179248192 AGAGAGAGAGAAGGGAAGGAAGG + Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918403380 1:184187395-184187417 AGGGAGAGGCAATTTACTGATGG + Intergenic
918892707 1:190295753-190295775 AGGGAAAGGGAAGTGAGTGTGGG - Intronic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919372158 1:196741378-196741400 GGAGAGAGAGGAGTGAGTGAAGG + Intronic
919534229 1:198766896-198766918 AGGGAGAAAGAAATAAATGAAGG + Intergenic
920199228 1:204249292-204249314 AGGGAGAAAGAAGGGGATGAAGG + Intronic
920212063 1:204335467-204335489 AGGGCTAGAGAAGAGTCTGAAGG + Intronic
920350194 1:205332870-205332892 GGGGAAAGAGAAGTGATGGAGGG + Intergenic
920481453 1:206326213-206326235 AGAGAGAGTGAAGGAACTGAAGG + Intronic
920509364 1:206539495-206539517 AGGGAGAGAGAAAGGCGTGAGGG - Intronic
920515528 1:206582174-206582196 AGAGCCAGAGAACTGACTGAGGG + Intronic
920538034 1:206753216-206753238 TGTGAGAGAGAAGAGACTCAAGG + Intergenic
920606167 1:207389012-207389034 AGGTAGAGAGTAGTCACTGGAGG + Intergenic
920649056 1:207823284-207823306 AGGGAGTGAGAAGTGCCGAAAGG - Intergenic
920730847 1:208482761-208482783 AGGGATAAAGAGGTGACTTAGGG + Intergenic
920780799 1:208989240-208989262 AAGGAGACAGAAGTGTCAGAGGG - Intergenic
920831423 1:209469220-209469242 AGGGAGAGAGAAGGGACCCATGG + Intergenic
921678670 1:218006237-218006259 AGGAAGAGTAGAGTGACTGAGGG - Intergenic
921980870 1:221257377-221257399 TGGGAGAAAGAAGTGAATCAAGG + Intergenic
922553094 1:226511650-226511672 AAGGAGAGAGAAGAGAGAGAGGG - Intergenic
922731942 1:227953139-227953161 AGGGAGACAAAAGAGACAGATGG + Intergenic
923300567 1:232636714-232636736 AGGGAGAGAGATGGGAAGGAAGG + Intergenic
923304380 1:232674630-232674652 AGAGAGAGAGAAAAGACAGAAGG + Intergenic
923672329 1:236051306-236051328 ATGAAGTGTGAAGTGACTGAGGG - Intronic
923751304 1:236748657-236748679 ATGGAGAGAGAAGGAACTGCAGG - Intronic
924206643 1:241718828-241718850 AGGGAGAGAGAGGGGAGAGAGGG + Intronic
924339678 1:243017098-243017120 AGGAGGAGAAAAGTGAGTGAGGG - Intergenic
924470919 1:244341925-244341947 AGAGAGAGAGAGGAGACTTAAGG - Intergenic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
924598664 1:245468688-245468710 AGAGAGAGAGAGGTGAGGGAGGG + Intronic
1063377497 10:5562696-5562718 AGCCAGAGAGGAGTGAGTGAGGG + Intergenic
1064295674 10:14076975-14076997 AGGGAGAGGGAAGAGTCTGGAGG + Intronic
1064402589 10:15033969-15033991 GGGGAGGGAAAAGAGACTGATGG + Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1065436465 10:25708230-25708252 GGAGCGAGAGATGTGACTGATGG - Intergenic
1065482521 10:26210105-26210127 AGAGAGAGAGAAGGGAGGGAGGG + Intronic
1065829479 10:29601590-29601612 AGAGAGAAACAGGTGACTGACGG + Intronic
1066000083 10:31096423-31096445 AGGGAGAGAAAGGGGAGTGAGGG + Intergenic
1066438751 10:35417482-35417504 AGGGAAAGAGAAGTTGATGATGG + Intronic
1067492843 10:46728456-46728478 AGGGAGAGAGAAGGGCAAGATGG - Intergenic
1067601821 10:47611939-47611961 AGGGAGAGAGAAGGGCAAGATGG + Intergenic
1067739731 10:48886141-48886163 AGGTCCAGAGAGGTGACTGAAGG - Intronic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068249742 10:54423281-54423303 AGGGAGAGAGAAGGGCAAGATGG + Intronic
1068519705 10:58064782-58064804 AGGGAGAGAGAAGGGAGGTAGGG - Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069076441 10:64042319-64042341 AGGGAGAGTGGAGTGAGTGCAGG - Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1070122227 10:73589018-73589040 AGGGAGAGAGAAGTCCCAGTTGG - Intronic
1070207932 10:74283408-74283430 AGGGAGAGAGAACTGAGTAATGG - Intronic
1070324010 10:75375943-75375965 AGGAAGTGAGAAGTGAGAGAGGG + Intergenic
1070930279 10:80256158-80256180 AGGCAGAGAGAAGAGAGAGAAGG + Intergenic
1071153784 10:82666487-82666509 AGGGAAAGAGTAGTGTCAGAGGG - Intronic
1071291703 10:84193909-84193931 AGGAAGAGTGAAGGGCCTGAAGG - Intergenic
1071653346 10:87419526-87419548 AGGGAGAGAGAAGGGCAAGATGG + Intergenic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1072775317 10:98185650-98185672 ATGAAGACAGAAGTGACAGAAGG + Intronic
1072813565 10:98482794-98482816 AGAAAGAGAGAAGTGAAAGATGG + Intronic
1073004699 10:100314415-100314437 GGGGAGAGAGAAGAGAGAGAAGG + Intronic
1073127958 10:101163660-101163682 AGGGAGAAAGGAGGGGCTGATGG - Intergenic
1073232406 10:101983225-101983247 AGGGAGAGAAGAGGGGCTGAAGG + Intronic
1073285341 10:102384068-102384090 AGGGAGGGAAGAGGGACTGAAGG + Intergenic
1073510416 10:104039317-104039339 TGGGAGAGAGAAGAGGCTGGAGG - Intronic
1073849156 10:107594285-107594307 AGGGAAAGAAATGTGAGTGACGG + Intergenic
1074038546 10:109765218-109765240 AGGAAGAGAGAGGTGACTAAAGG - Intergenic
1074984057 10:118641874-118641896 AGGGAAAGAGAAGGGAGAGAAGG - Intergenic
1075300921 10:121323407-121323429 AGGGAGAGAAAAGTTACAAAAGG - Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076183700 10:128430636-128430658 AGAGAGAGAGCAGGGACAGAGGG - Intergenic
1076585369 10:131543590-131543612 AGAGAGACAGGAGTTACTGAGGG + Intergenic
1077280263 11:1741456-1741478 CGGGAGAGAGAACAGGCTGATGG + Intronic
1078093562 11:8282873-8282895 AGGGAGTGATTCGTGACTGAAGG - Intergenic
1078521769 11:12069304-12069326 CGGGACAGAGCAGTGGCTGATGG - Intergenic
1078524755 11:12091800-12091822 AGGGAGAGAGGAGGGCGTGAGGG - Intergenic
1078806094 11:14706149-14706171 AGAGGGAGAGAAGGGAGTGAAGG - Intronic
1078930624 11:15909760-15909782 GGGGATAGAGAAGTGCATGATGG + Intergenic
1079106722 11:17576744-17576766 AGGGAGGGGGAAGTGAGTGAGGG + Intronic
1079229589 11:18638089-18638111 AGGGAGGGAGATGAGATTGAGGG - Intergenic
1079656731 11:22994521-22994543 GGAGAGGGAGAAGTGAGTGAAGG + Intergenic
1079746715 11:24141290-24141312 AGGGAGGGAGAAGTAATTGGAGG - Intergenic
1081206346 11:40280229-40280251 ACAGAGAGAGATGGGACTGAAGG + Intronic
1081501189 11:43668335-43668357 AAAGAGAGAGATGTGACTGTGGG - Intronic
1081522161 11:43892885-43892907 AGGGAGAAAACATTGACTGAGGG + Intronic
1081626533 11:44659260-44659282 AAGGATAGAGAAGTGGCTGGAGG + Intergenic
1081762719 11:45587823-45587845 AGAGAGAGAGAAATGAAGGAAGG + Intergenic
1081868450 11:46372344-46372366 AGGGAGAGGGGTGTGACTGTGGG - Intronic
1082194845 11:49291188-49291210 AGTGAGAGATAAGTTGCTGAGGG + Intergenic
1082825668 11:57576312-57576334 AGAGAGAGACAAGAGACTGGTGG - Intergenic
1083427080 11:62593770-62593792 AGGGAGTGAGGAGTGAATTAAGG - Exonic
1083538973 11:63498464-63498486 AGGGAGAGCATGGTGACTGAAGG - Intergenic
1083600318 11:63943275-63943297 AGGGACAGAGAAGCGTCGGATGG - Intronic
1083840384 11:65301157-65301179 AGGGAGGGAGGAGGGACAGAGGG + Intronic
1083891785 11:65599321-65599343 AGGGAGGGAGGAGTGGCTGGTGG - Intronic
1083956030 11:65983343-65983365 AGGTAGGGAGAAGAGCCTGAGGG + Intergenic
1084742772 11:71150111-71150133 AGGGAGGGAGAAGGGAGGGAAGG + Intronic
1084754447 11:71226364-71226386 AAGGAGAGAGAAGAGAGGGAGGG + Intronic
1084921199 11:72471445-72471467 AGAGATAGAGAAATGATTGAGGG - Intergenic
1085500381 11:77016441-77016463 TGAGAGAGAGAAGTGGCTGAGGG + Intronic
1085762825 11:79257042-79257064 AGAGACAGAGCAGTGAATGAAGG + Intronic
1086510577 11:87553678-87553700 AAAGAGAAAGAAGTGCCTGAAGG + Intergenic
1086661087 11:89418372-89418394 AGTGAGAGATAAGTTGCTGAGGG - Intronic
1087198014 11:95320105-95320127 AGGAAGAGAGAAATGACTTGAGG - Intergenic
1087350147 11:97020644-97020666 AGGGAGAGGGAAGAGTCAGAAGG + Intergenic
1087562957 11:99814944-99814966 CAGTAGAGAGAATTGACTGAAGG + Intronic
1087684348 11:101246158-101246180 AGGCAGAGAGAAGAGAGAGAGGG + Intergenic
1087684353 11:101246211-101246233 AGGCAGAGAGAAGAGAGAGAGGG + Intergenic
1087684358 11:101246264-101246286 AGGCAGAGAGAAGAGAGAGAGGG + Intergenic
1087739419 11:101870629-101870651 TGGGAGATGGAAGTGAATGAAGG - Intronic
1087740679 11:101883534-101883556 AGGGAGAGATATGTGCCTGATGG - Intergenic
1087959817 11:104334184-104334206 CAGGAGAGAGAAGCGAGTGAAGG + Intergenic
1087985228 11:104670520-104670542 TGGGAGAGAAAAATGACTAAAGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088620226 11:111674268-111674290 AGGGAGATAAAAGAGACAGAGGG - Intronic
1089131356 11:116214849-116214871 AGGGCAAGAGAAGTTTCTGAGGG - Intergenic
1090025401 11:123163265-123163287 AGTCAGTGAGGAGTGACTGAAGG + Intronic
1090227340 11:125079657-125079679 AGGGAGAGAGAAGGGAGGGTGGG - Intronic
1090450641 11:126803077-126803099 AGGAACTGAGAAGAGACTGAGGG + Intronic
1090476017 11:127021037-127021059 AGGGAGAAATCAGTGGCTGAAGG + Intergenic
1090791412 11:130093134-130093156 CGGGGCAGAGAACTGACTGAAGG + Intronic
1091296966 11:134480726-134480748 AGGCAGAGAGAACAGACAGATGG + Intergenic
1091565914 12:1647721-1647743 AGGGAGGAAGGAGTGATTGAGGG + Intergenic
1091632299 12:2171217-2171239 AGAGTGAGAGGAGTGTCTGATGG + Intronic
1091684567 12:2552509-2552531 AGAGTGTGAGAAGTCACTGAAGG + Intronic
1091708722 12:2721697-2721719 TGGGAGAGAGAAGTTAATGTAGG - Intergenic
1091860616 12:3778939-3778961 TGGGTGAGAGGAGAGACTGATGG - Intergenic
1092228579 12:6764625-6764647 AGGGAGAGGAAAGAGCCTGATGG + Intronic
1092232213 12:6782534-6782556 AGGGAGACAGGAGTCACTGGGGG + Intergenic
1092476670 12:8824687-8824709 AGAGAGAGAGAACAGAATGATGG - Intronic
1092801493 12:12172659-12172681 AGGAAGACAGATATGACTGAGGG + Intronic
1092911015 12:13145004-13145026 AAGGAGGGAGAAGTGACACAGGG + Intergenic
1093573583 12:20698377-20698399 AGGGAGTGGGAATTGACTAAAGG - Intronic
1094787027 12:33860383-33860405 AGGGAGAGAGAATTGAATCATGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096267448 12:50135092-50135114 AGGGAGAGAGAGGAGAGGGAGGG + Intronic
1096267455 12:50135115-50135137 AGGGAGAGAGAGGAGAGGGAGGG + Intronic
1096267467 12:50135153-50135175 AGGGAGAGAGAGGGGAGGGAGGG + Intronic
1096334068 12:50739811-50739833 AGTCAGAGAGATGTGCCTGATGG + Intronic
1096601999 12:52736007-52736029 AGGGAGAAAGATCTCACTGAGGG - Intergenic
1096980516 12:55725965-55725987 AGGGGCAGGGAAGAGACTGATGG - Intronic
1097118657 12:56717202-56717224 AGGGAGACAGGAGTCACTGCTGG + Intronic
1097378130 12:58862005-58862027 AAGGAGAGGGGAATGACTGACGG - Intergenic
1097649210 12:62275157-62275179 AGAGAGAGAGGATTGACTCAAGG + Intronic
1097883512 12:64706955-64706977 AGGAAGGGAGAAGTGACTGATGG + Intergenic
1098982698 12:76974745-76974767 AGGGATAGAGCTGTGACTGGTGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099259539 12:80360458-80360480 AGGGAGAGAGAGGAGAGAGAGGG - Intronic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1100193031 12:92213135-92213157 ATGGAGAGACAGGTGATTGAGGG + Intergenic
1100616489 12:96235278-96235300 AGGCAGAGAGAGGAGTCTGAAGG - Intronic
1100734078 12:97507514-97507536 AGAGAGGGAGAAGTTAATGATGG + Intergenic
1101681808 12:106975644-106975666 AGACACAGAGAAGTGACTAATGG - Intronic
1101770766 12:107748681-107748703 AGGGAATGGGAAGTGACTAATGG + Intronic
1101925701 12:108969662-108969684 AGGGAGGGAGAAGGGACAGAGGG - Intronic
1102266514 12:111490810-111490832 AGAGAGAGAGAAATGACTGTGGG + Intronic
1102340328 12:112116514-112116536 TGGGGGAGAGAACTGAGTGAGGG + Intergenic
1102699936 12:114830306-114830328 AGAGAGAGAGAGGGGACAGAGGG - Intergenic
1102943233 12:116962263-116962285 AGAGAAAGAGAAGAGAGTGAGGG - Intronic
1103231688 12:119336285-119336307 AGGGAGAGAGAGGAGAGTCATGG + Intronic
1103444349 12:120984473-120984495 TGGGAGAGAGAAGGGAAGGAGGG + Intronic
1103522455 12:121545611-121545633 AGGGAGAGCGGAGGGGCTGAGGG - Intronic
1103989852 12:124791607-124791629 GGGGAGATGGAAGTCACTGAGGG + Intronic
1104301404 12:127568389-127568411 AGGGAGAGAGAGATGAGAGAGGG + Intergenic
1104393726 12:128413681-128413703 ATTGAGAGAGAAGTGAGTAAAGG - Intronic
1104430593 12:128712935-128712957 ACGGAGAGAGAAGTGGCTTCAGG - Intergenic
1106141061 13:27012066-27012088 AAGGAGAGTGAAGTGAATGGAGG + Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1106358561 13:29008365-29008387 AGCGAGAAAAATGTGACTGATGG - Intronic
1106704988 13:32270719-32270741 AGGGAGAAAGAAGTAACAGAAGG - Intronic
1106793710 13:33183017-33183039 AGGGAGAGGAATGTGACAGATGG - Intronic
1107443298 13:40447428-40447450 AGGGAGAAAGAAGGGAGGGAGGG + Intergenic
1107605933 13:42056816-42056838 AGGGAGAGAGAAAAGAGCGAAGG - Intronic
1107641525 13:42448214-42448236 AGAGAGAGAGGGGTGAGTGAAGG - Intergenic
1107780371 13:43895318-43895340 AGTGAGATAGAAGTGGGTGAGGG - Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1109094909 13:58101691-58101713 GGGGAGAGAGAAGAGGCTCAGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1110827695 13:79991696-79991718 AGTGAGAGAGAAGTCACAGATGG - Intergenic
1111295230 13:86268934-86268956 AGAGAGAGAGAAGGGAGGGAGGG - Intergenic
1111685802 13:91499368-91499390 AGGGAGAGAAAAGTGAGAGATGG + Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1112975401 13:105311600-105311622 AGGTAGAGAGAATTGAATCATGG - Intergenic
1113337652 13:109392610-109392632 AGAGAGAGAGAAAGGAATGAAGG + Intergenic
1113532652 13:111040250-111040272 AAGAAGAAAGAAGCGACTGATGG + Intergenic
1113808960 13:113126099-113126121 TGGCAGAGAGAGGTGAATGAGGG + Intronic
1114854765 14:26424837-26424859 AGGGAGGGAGAAGGGAAGGAAGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115186364 14:30692453-30692475 AGGGAGAGAGTAGGGATTGAAGG + Intronic
1115604051 14:34982677-34982699 AGAGATAGAGGTGTGACTGAAGG - Intronic
1115990903 14:39148485-39148507 AGGGAGAACGAAATGGCTGATGG + Exonic
1116492822 14:45526556-45526578 GGGGTGAGTGAAGGGACTGAGGG + Intergenic
1116828102 14:49691677-49691699 AGGGAGGGGGAGGGGACTGATGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117557959 14:56906099-56906121 AGGGACAGAGCAGTGGCTTAAGG + Intergenic
1117897817 14:60506675-60506697 AGGGACTGAGAAGTGCCTGGAGG - Intronic
1118008918 14:61590283-61590305 AGGCAGGGAGAAGAGTCTGAGGG + Intronic
1118175177 14:63432651-63432673 AGGAAAAGAGAAGAGACTGGGGG + Intronic
1118368223 14:65113777-65113799 TGGGAGAGAGAAGTAACTCCAGG + Intergenic
1118382721 14:65230392-65230414 AGAGAAAGAGGAGTGACTGCCGG - Intergenic
1119124682 14:72114731-72114753 AGGGAGACAGAACTGACTTAAGG + Intronic
1119939686 14:78627093-78627115 AGAGAGAGAGAAGGGAGGGAGGG - Intronic
1119948644 14:78721489-78721511 AGAGAGAGAAAGGTGAATGAAGG + Intronic
1120003093 14:79325956-79325978 AGGTAGAGAGAAGGGTCTGCGGG + Intronic
1120324163 14:83004558-83004580 GGTGAGAGAGAAGTGACAGCAGG + Intergenic
1120565780 14:86054839-86054861 TAGGAGAGAGAAATTACTGAGGG - Intergenic
1120664679 14:87291994-87292016 AGGGAGAGAGAAAAGAAGGAAGG - Intergenic
1122359455 14:101150891-101150913 AGGGAGAGAGGAGGGAAGGAAGG - Intergenic
1122359471 14:101150971-101150993 AGAGAGAAAGAAGGGACAGAGGG - Intergenic
1122446969 14:101776689-101776711 GGGGAGTGAGGAGTGACTGCTGG - Intronic
1122543839 14:102511540-102511562 GGGGAGAGCAAAGTGAGTGAAGG + Intergenic
1122628941 14:103098707-103098729 GGGGAGAGAGAAGCGAGTGGAGG + Intergenic
1122840721 14:104461520-104461542 CGGGAGAGAGAAGAGGCTGTGGG + Intergenic
1123159021 14:106259350-106259372 AGTGAGAGAGAAATGACGGGAGG - Intergenic
1123164662 14:106314888-106314910 AGGCAGAGGGCAGTGTCTGAGGG + Intergenic
1123453748 15:20396194-20396216 AGGGAGAAAAGAGTGAGTGAGGG - Intergenic
1123758087 15:23412447-23412469 AAGGAGAGAGAGGTTAGTGATGG + Intergenic
1124067325 15:26356497-26356519 ACAGACAGAAAAGTGACTGAGGG + Intergenic
1124153100 15:27199912-27199934 AGGGAAAGAGAAATGGCTGAAGG - Intronic
1124215878 15:27806881-27806903 TGTGAGAGTGAAGAGACTGAGGG - Intronic
1124503337 15:30250033-30250055 AGAGAGAGAGAAATGAATGATGG + Intergenic
1124571873 15:30871994-30872016 AGAGAGAGAGAAGAGAGGGAGGG - Intergenic
1124740218 15:32288606-32288628 AGAGAGAGAGAAATGAATGATGG - Intergenic
1125339859 15:38664121-38664143 AGGGAAAGAAATGTCACTGAAGG + Intergenic
1125569538 15:40705437-40705459 ATGGAGAGAGAAAAGATTGAAGG + Intronic
1126489145 15:49216808-49216830 AGGGAGGGTGAAGTGAGTGTGGG - Intronic
1126664559 15:51064674-51064696 AGGGAGAGAGAGGGCACTGAGGG + Intronic
1126787281 15:52187365-52187387 AGAGAGAGAGAAGGGACGGCAGG + Intronic
1127000123 15:54493387-54493409 AGAGAGAGAGGAGAGAGTGAGGG - Intronic
1127254608 15:57278720-57278742 AGGGAGAGAGAGGGGAGGGAGGG - Intronic
1127446350 15:59067169-59067191 AGGGAGAGAGACAGGAATGAAGG - Intronic
1127788675 15:62378862-62378884 AGGGAGAGAGAAAGGAAGGAAGG + Intergenic
1128077943 15:64840177-64840199 AGAGAGAGAGAAGGGAGGGAGGG - Intergenic
1128234772 15:66059954-66059976 AAGGACAGGGAAGTGTCTGAGGG + Intronic
1128701956 15:69811153-69811175 AGGGAGGGAGAAGAGACTGAAGG - Intergenic
1129120367 15:73392790-73392812 AGAGAGAGAGAAGGGAGGGAGGG + Intergenic
1129556456 15:76515286-76515308 AGGGTGAGTGCAGTAACTGAAGG + Intronic
1129706299 15:77796502-77796524 AGAGAGAGAGAAGGGACACATGG + Intronic
1129744367 15:78007884-78007906 AGGGTGACAGGAGGGACTGAAGG - Intronic
1130010937 15:80152727-80152749 AGGGAGGGAGGAGAGACTGGAGG + Intronic
1130148783 15:81295240-81295262 AGGGAGGGAGAAGAGAAAGAAGG - Intronic
1130924595 15:88375594-88375616 GGGGAGAGAAAAGAGAGTGAGGG - Intergenic
1131098188 15:89669233-89669255 GGGGAGATAGAAGTGAGTGGTGG + Intronic
1131145033 15:90005288-90005310 AGGGACAGGGAGGTGATTGATGG + Intronic
1131248963 15:90818676-90818698 ACGGAGGGAGAAGTGGCTGCTGG - Intergenic
1131682511 15:94738789-94738811 AGGGACTGAGAAGAGACTTAAGG - Intergenic
1131696035 15:94878857-94878879 AGGGAAAGACAAGAGACAGAAGG - Intergenic
1132187590 15:99815364-99815386 AGGGAAAGGAAAGTTACTGATGG + Intergenic
1132293779 15:100720384-100720406 AGGGAGGGAGAAGGTGCTGAGGG + Intergenic
1132311099 15:100858567-100858589 AGTGAGAGCTCAGTGACTGAAGG - Intergenic
1132379844 15:101358799-101358821 AGGGTGAGGGAAGGGAGTGATGG - Intronic
1132798836 16:1741543-1741565 AGGGACTGAGACGTGTCTGATGG + Intronic
1133161453 16:3914807-3914829 AGGCAGAGAGAAGTGGAAGAGGG - Intergenic
1133656753 16:7872217-7872239 AGGGAGAAAGAAGAGAGGGAGGG - Intergenic
1134225309 16:12385485-12385507 AGGCAGGGAGAAGTGAAGGAAGG + Intronic
1134316867 16:13126933-13126955 AGGGAGAGAGAGCTGAGGGAAGG + Intronic
1134458254 16:14410447-14410469 AAGGAGAGAGAGGTTAGTGATGG - Intergenic
1134811624 16:17172187-17172209 AGGGAGAGAGGAGGGAAGGAAGG - Intronic
1134907327 16:17991440-17991462 AGAGAGAGAGATGAAACTGATGG - Intergenic
1135123518 16:19786804-19786826 AGAGAGAGAGAAGGGAGGGAGGG + Intronic
1135296012 16:21279908-21279930 AGAGAGAGAGAAGACACTGGTGG + Intronic
1135334911 16:21593138-21593160 AGGGAGAGAGTAGCAGCTGAGGG - Intergenic
1135932199 16:26747672-26747694 GGGGAGAGAGAGGGGAGTGAGGG - Intergenic
1135985179 16:27178816-27178838 GGGGAGAGAGAAGAGAGAGAGGG - Intergenic
1136268014 16:29132137-29132159 AGGGAGAAAGAAGGGAGAGAGGG + Intergenic
1136600980 16:31288147-31288169 AGGGAGAGAGAATGGAATGGAGG + Intronic
1137092424 16:36210544-36210566 AGGGATAGAAAATTGAGTGATGG + Intergenic
1137362382 16:47830631-47830653 AGGGAGAGAGAAATAACTCCAGG - Intergenic
1137862343 16:51858713-51858735 AGGAAGAGAGAGGAGGCTGATGG - Intergenic
1137921760 16:52496184-52496206 TGGGAGACAGAATTAACTGAGGG + Intronic
1138723667 16:59111714-59111736 AGGGAGAGAGAGATGACATACGG - Intergenic
1138929147 16:61631205-61631227 AGAGAGAGAGAAGGGATGGAGGG + Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140127072 16:72126322-72126344 AGAAAGAGAGATGTGGCTGAGGG - Intronic
1140155957 16:72426982-72427004 AGGGAGAGAGAGGAGAGAGAAGG + Intergenic
1140680372 16:77379131-77379153 TGGGAAAGAGAAGTGACCAATGG + Intronic
1140977090 16:80070382-80070404 AGGGAGAAGGATGTGAATGAGGG - Intergenic
1141009541 16:80384650-80384672 AGAGAGAGAGAAGGGAAGGAAGG + Intergenic
1141261932 16:82462254-82462276 AGGGATAGTTAGGTGACTGAGGG + Intergenic
1141695236 16:85615989-85616011 AGAGACAGGGAAGTGACTGCTGG - Intronic
1142280806 16:89146629-89146651 GGGGAAAGTGAAATGACTGAGGG - Intronic
1142540699 17:656814-656836 AGAGAGAGACAAGAGACTGGCGG - Intronic
1142897447 17:2991125-2991147 GTGGAGAGAGGAGGGACTGATGG - Intronic
1143085602 17:4413642-4413664 AGAGAGAGAGAAGGGAGGGAGGG - Intergenic
1143622166 17:8086952-8086974 AGGGAGAGAGAAGAAAAGGATGG + Intronic
1144404474 17:14939502-14939524 AGGGAGAGGGGAGCGACGGAGGG + Intergenic
1144457575 17:15431711-15431733 AGAGAGAGAGAAGGGACGGGAGG - Intergenic
1144759946 17:17701457-17701479 AGAGTGAGAGAAGGGAATGAGGG - Intronic
1145916365 17:28576381-28576403 TGAGAGAGAGATGAGACTGAGGG + Intronic
1145917213 17:28581735-28581757 TGAGAGAGAGATGAGACTGAGGG - Intronic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146306812 17:31736279-31736301 AGAAAGAGAGAAGTGAGGGAGGG + Intergenic
1146392789 17:32438386-32438408 GGGGAGGGAGACGAGACTGAGGG + Intergenic
1146721297 17:35125730-35125752 TGGGAGACAGAAGTGTCTGGGGG + Intronic
1146742432 17:35298361-35298383 AGAGAGAGAGAAGAGGATGAGGG - Intergenic
1147122567 17:38344121-38344143 AGGGAGAGAGATGGGAGGGAAGG + Intergenic
1147502610 17:40980055-40980077 AGAGAGAGAGAAGAGACTCTGGG + Intronic
1147601184 17:41746580-41746602 AGGGTGTGAGAAGTGACAGTGGG - Intergenic
1147626800 17:41905664-41905686 AAGGAGACAGAAGTCAGTGATGG + Intronic
1147661215 17:42118065-42118087 AGAGAGAGAGAAGTCAGGGACGG + Intronic
1147761001 17:42797337-42797359 AGGGAGAGAGAGGTGGATGAAGG - Intronic
1148682841 17:49484502-49484524 AGGCAGAGAGAAGAAACAGAAGG - Intergenic
1148839512 17:50485792-50485814 AGGGGGAAGGAAGTGAGTGAGGG - Exonic
1149095022 17:52829204-52829226 AGGGAGAGAGAAGGCATTGAGGG + Intergenic
1149198958 17:54160298-54160320 AGAGAGAGAGACGTGAGTGTTGG - Intergenic
1149466431 17:56883550-56883572 AAGGAGAATGAAGAGACTGAGGG + Intergenic
1149797078 17:59530498-59530520 AGGGAGAGAGAAGGGAGGGAGGG + Intergenic
1149906785 17:60533872-60533894 AGGGAGAGAAGAGGGACTAAAGG + Intergenic
1150060762 17:62066021-62066043 GGGGAGAGAGAAGTGAGCGAGGG + Intergenic
1150519613 17:65852385-65852407 AGGGAGAGGGAAGGGAGGGAGGG - Intronic
1150587447 17:66531661-66531683 AGGGAGACAGCAGTGACAGGAGG - Intronic
1150936133 17:69637667-69637689 AGAGAGAGAGAGGTGATTAAGGG + Intergenic
1150978980 17:70120631-70120653 AGAGAGAGAGAAGTGTCTGGGGG + Intronic
1151187292 17:72373679-72373701 CAGGAGAGAGAAGAGAGTGAGGG - Intergenic
1151799007 17:76366477-76366499 AGAGGGAGAGAAGTGAGGGAAGG + Intronic
1152182059 17:78828638-78828660 AGGGAGAGAAGAGTGAGTCATGG - Intronic
1152519448 17:80846643-80846665 AGGGAGAGAGAAGGCACTCCCGG - Intronic
1153075905 18:1161260-1161282 AAGGAGAGACAAATGAGTGATGG - Intergenic
1153093893 18:1379458-1379480 AATGAAAGAGAAGTGAGTGAAGG + Intergenic
1153354486 18:4120723-4120745 AGGGAGGGAGAAGGGAAGGAAGG - Intronic
1153446604 18:5179912-5179934 GGGGACAGAGAAGCTACTGAAGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1154405366 18:14085695-14085717 AAGGTGAGTGATGTGACTGAAGG + Intronic
1154406374 18:14095748-14095770 AGGGAGAGAGAAGTAAATGCAGG - Intronic
1155223560 18:23707525-23707547 AGAGAGAGAGAAGGAATTGATGG + Intronic
1155858957 18:30872094-30872116 AGAGAGAGAGAAGAGACAGAGGG - Intergenic
1155969033 18:32063899-32063921 AGGGAGAGAGAAGGAAATAAAGG + Intronic
1156860732 18:41833427-41833449 ATGGAAAAAGAAGTGACTGTTGG + Intergenic
1157197592 18:45631962-45631984 AGGGAGAGAGAAGAGAGGGAAGG - Intronic
1157410454 18:47458812-47458834 AGGAAGAGAGAAATGACAGAGGG + Intergenic
1157442521 18:47721645-47721667 AGGGAGAGAAAAGTGAGAAAAGG + Intergenic
1157612714 18:48968430-48968452 AGGGAGAGGGAAGGGAAGGAGGG + Intergenic
1157612748 18:48968540-48968562 AGGGGGAAAGAAGGGACGGAGGG + Intergenic
1158212492 18:55066943-55066965 AGAGAGAGAGAGGGGAGTGAGGG - Intergenic
1158225113 18:55192745-55192767 AAGGAGATTAAAGTGACTGAGGG + Intergenic
1159003102 18:62990420-62990442 AGGGAGATAGAGGTGCCAGAGGG - Intergenic
1159274892 18:66206088-66206110 AAGGAGACACAAGTGACTGGTGG - Intergenic
1159443650 18:68512844-68512866 ATGGAGAGAGAGTTGTCTGAGGG - Intergenic
1159475444 18:68915012-68915034 AGAGAGAGAAACGTGAATGAGGG + Intronic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1159797173 18:72858604-72858626 AGGTAAAGAGTAGTGACTCAAGG - Intronic
1159957772 18:74531958-74531980 AGGGAGAGAGGAGAGAGAGATGG - Intergenic
1160356190 18:78229829-78229851 AGGGAGGAAGAAGGGAGTGAAGG - Intergenic
1160597011 18:79982720-79982742 AGAGAGAGGGAAGTTACTGTGGG + Intronic
1160951556 19:1669964-1669986 AGAGAGAGAGAAGCGAGGGAAGG - Intergenic
1161041401 19:2112509-2112531 AGGGAGTGAGAAGTAACGGCTGG + Intronic
1161184275 19:2905991-2906013 AAGGAGAGAGAAATGAGAGATGG - Intronic
1161540001 19:4844802-4844824 GGGGAGAGAGAAGTGAGGGAAGG + Intronic
1161905163 19:7151085-7151107 AGGGAGAGAGGAGGGAAGGAAGG - Intronic
1161960111 19:7518460-7518482 AGGGAGAGAGAAAGGAAAGAAGG + Intronic
1162585486 19:11555664-11555686 AGGGAGAGAGGAGGGACAGGTGG + Intronic
1163105615 19:15121440-15121462 AGGCAAAGGGAAGGGACTGAGGG + Intronic
1163110846 19:15160376-15160398 AAGGAGAGAGAAAGGAATGAGGG + Exonic
1164411118 19:28006263-28006285 AGGGAGAGAGAAGAGATGGCCGG - Intergenic
1164526383 19:29016484-29016506 AGGGGGAGAGGAGAGACAGAGGG - Intergenic
1164561115 19:29292923-29292945 AGCGAGAGAGAAGAAACTGTGGG + Intergenic
1164651636 19:29895036-29895058 AGGGAGGGAGTAGGGAATGAGGG + Intergenic
1164651642 19:29895055-29895077 AGGGAGGGAGTAGGGAATGAGGG + Intergenic
1164925072 19:32124159-32124181 AGGGAGAGAGAAAGGAATGGAGG + Intergenic
1165186042 19:34022675-34022697 AGGGAGAGACAAGAGACTGGTGG - Intergenic
1165902202 19:39174197-39174219 AGGGACAGAGATGTGGGTGAGGG - Intronic
1165933214 19:39373552-39373574 ATGAAGGGAGAAGTGGCTGATGG + Intronic
1166542875 19:43617206-43617228 GGAGAGAGAGAAGTCACAGAAGG - Intronic
1166730995 19:45058997-45059019 AGGGAAAGAGAAGGGAGAGATGG - Intronic
1166746250 19:45143221-45143243 AGGGAGACAGTGGTGACTGTGGG + Intronic
1166910216 19:46149150-46149172 AGAGAGAGAGAAGAGAGAGAGGG - Intronic
1167173953 19:47852616-47852638 AGGGAGAGAGAAAGGAAGGATGG - Intergenic
1167327900 19:48836580-48836602 GGGAAGAGAGGAGTGTCTGAGGG - Exonic
1167452482 19:49580305-49580327 AGAGAGAGAGAACTGCCCGATGG + Intronic
1167820126 19:51920227-51920249 AGGGAGAGAGAGGTAACGGTTGG - Intronic
1168465004 19:56595054-56595076 AAGGAGAGAGAAGAGACGGAGGG - Intergenic
925062502 2:904301-904323 TGTGAGAGAGAATAGACTGAGGG - Intergenic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
925146861 2:1587867-1587889 AGGGACAGAGCAGGGACAGAGGG - Intergenic
925590077 2:5500783-5500805 AGGGAGAGAGAAGGGAGAGGAGG + Intergenic
926298724 2:11587292-11587314 AGGGACAGAGAAGTGACAAGGGG - Intronic
926481547 2:13403050-13403072 AGGGAGAAAAGAGTGAGTGAGGG + Intergenic
926937227 2:18098163-18098185 AGGGAGGGAGAGAGGACTGAAGG - Intronic
927019177 2:18999535-18999557 AGAGAGAGAGAAGGGAGGGAGGG - Intergenic
927045163 2:19270940-19270962 ACAGGGAGAGAAGTGATTGAGGG - Intergenic
927469855 2:23365175-23365197 AGAGAGAGAGAAGAGAGGGAGGG + Intergenic
927699089 2:25256675-25256697 AGGGAAAGATAAGGGACAGAAGG - Intronic
927699093 2:25256695-25256717 AGGGAAAGATAAGGGACAGAAGG - Intronic
927764568 2:25793552-25793574 AGGGAGAGATCAGACACTGAAGG + Intronic
928122918 2:28596745-28596767 GGGGAGCGAGAACTGAGTGAAGG + Intronic
928383834 2:30847088-30847110 AGCAAGAGAGAAGTCACTGGGGG - Intergenic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
929060026 2:37914321-37914343 AGGGTGGTAGATGTGACTGAGGG - Intergenic
929337239 2:40763829-40763851 AGGTAGAGATAAGTGAGTTATGG - Intergenic
929615749 2:43305960-43305982 AGAGAGAGAGAAGGGAGGGAGGG - Intronic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930447411 2:51491312-51491334 AGGGAAAGAGAAATGAGAGATGG + Intergenic
930539685 2:52690153-52690175 AGGGGGAGATAAGTGTCTGGAGG + Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931146784 2:59527953-59527975 AGGCAGAGAGAAGACAGTGAAGG + Intergenic
932657878 2:73626106-73626128 AGGGTTAGAGAAGACACTGAGGG - Intergenic
933015945 2:77127592-77127614 AGAGAGAGAGAAGAGAGAGAGGG - Intronic
933127918 2:78634280-78634302 AGGGAGAGAAAAAGGAATGAAGG + Intergenic
933351545 2:81158734-81158756 ATGGAGAGAGCAGTGACTGCGGG + Intergenic
934652531 2:96100604-96100626 AAGGAGAGAGGAGAGAGTGAGGG + Intergenic
935152705 2:100451970-100451992 AGGAAGAAAGAAGTCACTGCAGG + Intergenic
935263310 2:101373729-101373751 AGGGAGAAAGAAGTGACTGCAGG + Intronic
935431481 2:102980592-102980614 AGGGAGAGGAAACTTACTGAGGG - Intergenic
935619769 2:105118981-105119003 AGGCAGAGAGGAGACACTGAAGG - Intergenic
935666165 2:105514930-105514952 AGGGAGAAAGAAAGGAGTGACGG - Intergenic
935957387 2:108390935-108390957 AGGGAGAGACAATCTACTGATGG + Intergenic
936237169 2:110752525-110752547 AGAGAGAAAGTAGTGATTGAGGG + Intronic
936272813 2:111063936-111063958 AGAGAGAGAGAAAGGACGGAAGG + Intronic
936387920 2:112047061-112047083 AGAGGGAGAGAAGTGAGTGGGGG - Intergenic
936706382 2:115079712-115079734 AGTGAGAGAGAAGTGTCTAGAGG + Intronic
936768334 2:115880581-115880603 AGAGAGGTAGAAGTCACTGACGG + Intergenic
936907245 2:117551211-117551233 AGGGAGGGAGAAAGGACAGAGGG + Intergenic
936946304 2:117934054-117934076 GGGGAGAGTGAAGAGAGTGAAGG + Intronic
936994568 2:118399323-118399345 AGAGGGAGAGAATTGACTCATGG + Intergenic
937047491 2:118859377-118859399 AGAGAGAAGGAGGTGACTGAGGG + Intergenic
937363605 2:121245508-121245530 TGGGAGGGAGAAGTGGCTGGAGG - Intronic
938382895 2:130846566-130846588 GGCGAGAGAGAAGGGACTTAGGG + Intronic
939035329 2:137123778-137123800 AGGAAGAGAAATGAGACTGAGGG - Intronic
939125858 2:138176821-138176843 GGGGAGAGAGAAGGGAAAGAAGG + Intergenic
939195537 2:138966445-138966467 CAGGAGAGAGAAGTGTGTGAAGG + Intergenic
939238310 2:139526072-139526094 AGAGAGAGAAGAGTGAGTGAAGG + Intergenic
939378390 2:141400626-141400648 AGAGAAAGTGAAGTGTCTGAAGG - Intronic
940268787 2:151869299-151869321 AGGGAGAGAGGAGGGAGGGAAGG + Intronic
940357493 2:152761319-152761341 AGGGAGTGAAAATAGACTGATGG - Intergenic
940408651 2:153334951-153334973 AGGGAGAGATAATTGAATCATGG + Intergenic
940672754 2:156690185-156690207 AGTGAGAGAGAAGTGCAAGATGG - Intergenic
940743884 2:157545503-157545525 AGGGAGAGAGGTGTGAGTAAGGG - Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940832869 2:158487784-158487806 AGAGAGAGAGAAGAGAGAGAAGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941087527 2:161134952-161134974 AGGGAGAGAAGAATGGCTGAGGG - Intergenic
941129897 2:161634850-161634872 AGGTAGGGAGAAGGGAATGATGG - Intronic
941214828 2:162693612-162693634 AGGAAGAGAGAAACCACTGATGG + Intronic
941467492 2:165846323-165846345 GAGGAAAGAGAAGTGACTGTTGG + Intergenic
941659069 2:168176517-168176539 AAGGAGAGGGAGGTGACGGAGGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941894500 2:170615513-170615535 AGACAGAGGGAAGTGAGTGAGGG + Intronic
941950057 2:171145904-171145926 ATGGAGAAGGTAGTGACTGATGG + Intronic
942595893 2:177591611-177591633 TGGAAGATAGAAGTGGCTGAGGG + Intergenic
942632997 2:177972279-177972301 AGGAAGAGAACAGTGACAGAAGG + Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
942925042 2:181421403-181421425 AAGGAGAAAGAAATGAGTGATGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943145736 2:184042787-184042809 AGGGAGAGATAATTGAATCATGG + Intergenic
943180739 2:184537499-184537521 AGGGAGAGAGAAAGGAAGGAAGG + Intergenic
943355471 2:186849745-186849767 AGGCAGAGAGAAATGACTTAAGG - Intergenic
943375015 2:187065888-187065910 AGGAAGAGGGAAGTGCCTAATGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
944034290 2:195274954-195274976 AGCCAGAGAGAAGGGACAGATGG + Intergenic
944096050 2:195968931-195968953 AGGGACAGCGTAGTGACTGGGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944739328 2:202596178-202596200 AGGGAGAGAGATGTGAGTTGAGG + Intergenic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944994155 2:205275098-205275120 CTTGAGAGGGAAGTGACTGAAGG + Intronic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
945406979 2:209460557-209460579 AGGGAAAGAGAAGGGAAGGAAGG - Intronic
945755172 2:213836937-213836959 AGAGAGAGAGAAGGCACTGTTGG - Intronic
945946823 2:216002787-216002809 AGGGAGAAAGGAGGGACTGAAGG - Intronic
946002902 2:216497979-216498001 AGGGACAGAGAATTGACGGTGGG + Intergenic
946046641 2:216826819-216826841 AGGGAGTGATAAGTGCCTTAAGG - Intergenic
946050549 2:216858743-216858765 AGAGAGAGAGAACTGACTTTAGG - Intergenic
946063860 2:216969163-216969185 AGGGAACGACAAGTGACAGAAGG + Intergenic
946109416 2:217401241-217401263 AGGGAGAGAGCTGTGTGTGATGG - Intronic
946265553 2:218538288-218538310 ATGGAGAGAGAAGTGGGTCATGG + Intronic
946508175 2:220324102-220324124 TGGGAGAGTGATGTGATTGATGG + Intergenic
947048602 2:226017718-226017740 AGAGAGAAAGAACTGAGTGAAGG + Intergenic
947436067 2:230073411-230073433 AGGCAGAGGGAAGTGTCTGTAGG + Intergenic
947691969 2:232146762-232146784 AGGAAGACAGAAGTGAATGTTGG + Intronic
947742136 2:232489537-232489559 AAGGAGGGAGGAGAGACTGAGGG - Intergenic
947941901 2:234064144-234064166 AGAGAGAGAAAAGGGAATGAGGG - Intronic
948202723 2:236141619-236141641 AGAGAGAGAGAAGTGTAGGATGG - Intergenic
948332028 2:237177258-237177280 AGGGAGAGAGATGCCACAGAGGG + Intergenic
948352022 2:237348671-237348693 TGGGAAAGAGATGTGACTGTAGG + Intronic
948629397 2:239292313-239292335 ACGCAGAGAGCAGTGAGTGAGGG - Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
949002002 2:241620241-241620263 AGTGAGTGAGGAGTGAGTGAGGG + Intronic
1168732100 20:93430-93452 AATGAGAGAGAAGTGAATGCAGG - Intronic
1168960203 20:1863872-1863894 AGGGAGAGGGAAGTGAGACAGGG + Intergenic
1169001626 20:2171990-2172012 AGAGAGAGAGAAGAGAAAGAAGG + Intronic
1169564696 20:6841278-6841300 AGAGAGAGAGAAGGGAGGGAGGG + Intergenic
1169954394 20:11084952-11084974 AGGGTGAAAGAAGAAACTGAAGG + Intergenic
1170332323 20:15227354-15227376 AGGGAGGGAGAAGGGAGGGAGGG - Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171014423 20:21527083-21527105 AGTGATTGAGAAGTCACTGAGGG + Intergenic
1171037187 20:21724523-21724545 AGGGAGAGAAGAGCCACTGAAGG - Intergenic
1171147752 20:22800639-22800661 AGGGAGGGGGAAGTGAGTCAAGG - Intergenic
1171151769 20:22833945-22833967 AGGGAGAGAAAGATGAATGATGG + Intergenic
1171254599 20:23679912-23679934 AGGACAAGAGAAGTGACTCAGGG + Intergenic
1171261084 20:23735184-23735206 AGGATAAGAGAAGTGACTCAGGG + Intergenic
1171467634 20:25341907-25341929 AGGGACACAGAAGTAACTGCAGG - Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172448499 20:35005599-35005621 AGGGAGACAAGAATGACTGAGGG - Intronic
1172589194 20:36105653-36105675 AGGGAGAGAGAAGTGGCCAGTGG - Intronic
1172778443 20:37421713-37421735 AGGGAGACAAAAGTGAGTGGAGG - Intergenic
1172843014 20:37913428-37913450 AGGGAGAGAGAAAGGACTCCAGG - Intronic
1173443197 20:43095947-43095969 AGGGAAAGAGAAGGGAGAGAGGG - Intronic
1173443229 20:43096075-43096097 AGGGAAAGAGAAGGGAGAGAGGG - Intronic
1173600619 20:44292452-44292474 AGAGAGAGAGAAGGGAGGGAGGG + Intergenic
1173959016 20:47057055-47057077 AGGGAGAAAGAAGGGAGGGAGGG + Intronic
1174058287 20:47814854-47814876 AGGGAGAGTGACATGACAGATGG + Intergenic
1174191884 20:48746592-48746614 AGGGAGGGAGGACTGACTGAGGG + Intronic
1174385897 20:50188683-50188705 GGTGTGAGAGGAGTGACTGAGGG + Intergenic
1174531621 20:51219112-51219134 AGGGAGACAGAAATGACTGCTGG + Intergenic
1174685451 20:52450532-52450554 AGAGACAGAGAATTGAATGATGG - Intergenic
1175010890 20:55734593-55734615 CAGGAGAGAGAAGTGTTTGAAGG + Intergenic
1175561204 20:59932866-59932888 GGAGGGAGAGAAGGGACTGAAGG + Intronic
1175761365 20:61564001-61564023 ACGGACAGAGAAGTGAATGAGGG - Intronic
1176691025 21:9909161-9909183 AAGGAGAGAAAAATGACAGAAGG - Intergenic
1176701907 21:10063583-10063605 AGGGAGAGGGATCTGTCTGAAGG + Intergenic
1176935844 21:14866020-14866042 AGGCAGAGGGAAATAACTGAGGG - Intergenic
1176956281 21:15107888-15107910 AGGGTGAGGCAAGGGACTGATGG + Intergenic
1177161047 21:17548483-17548505 AGAGAGAGAGAAGGGAGAGAAGG - Intronic
1177210919 21:18069934-18069956 AGGGAGGAAGAAGTGAGGGAGGG - Intronic
1177821360 21:26034237-26034259 AGGGAGAGAGAGGGGAAGGAAGG - Intronic
1178018173 21:28376657-28376679 AGAGAGAGAGAAGTGCCACAAGG + Intergenic
1178530755 21:33373592-33373614 AGGGTGAGAGATTTGCCTGAGGG + Intergenic
1178765243 21:35444552-35444574 AGAGAGAGAGAAGAGAGAGATGG - Intronic
1179039897 21:37793340-37793362 TGGGGGAGAGAGGTGACTCATGG - Intronic
1179050953 21:37888227-37888249 AGAGAGAGGAAAGTGTCTGAGGG - Intronic
1179106478 21:38404998-38405020 AGGGAGGGAGAAGCGAAGGAAGG - Intronic
1179302335 21:40123804-40123826 AGGGAGGGAGAAGGGAGGGAGGG + Intronic
1179352129 21:40621890-40621912 AGAGAGAGAGAAGGGAGGGAGGG + Intronic
1180135260 21:45858183-45858205 AGAGAGACAGAAGTTACTGTAGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180990426 22:19932485-19932507 AGGGATGGAGAAGGGACTGGAGG + Intronic
1181257443 22:21572947-21572969 AGGCAGAGAAGAGAGACTGAAGG - Intronic
1181907327 22:26209738-26209760 AGGGAGAGAGGAGAGAAGGAAGG + Intronic
1182076411 22:27498392-27498414 CAGGAGACAGGAGTGACTGATGG + Intergenic
1182111718 22:27728243-27728265 AGAGAGAGAGAAGGGAGGGAGGG + Intergenic
1182661671 22:31929472-31929494 GGGGGGAGGGAAGGGACTGAAGG + Intergenic
1182812718 22:33131285-33131307 AGAGAGAGAGAACAGACTCAGGG - Intergenic
1183021732 22:35032902-35032924 AGAGAAAGAGAAGAGAATGATGG + Intergenic
1183186077 22:36292372-36292394 GTGGAGAGGGAAGTGACTGGGGG - Intronic
1183579992 22:38718607-38718629 AGGGAGAGGGAAGTGCCAGCTGG + Intronic
1183618319 22:38958305-38958327 AGAGAGAGAGAATTGAAGGAAGG - Intronic
1183654685 22:39177698-39177720 AGGCAGAAGGAGGTGACTGATGG - Intergenic
1183698815 22:39438212-39438234 AGGGAGGGAGAAGGGAAGGAAGG - Intergenic
1183698827 22:39438247-39438269 AGGGAGGGAGAAGGGAGGGAAGG - Intergenic
1183757880 22:39787250-39787272 AGGGAGAGAGAGATGAGGGATGG - Intronic
1183838162 22:40474668-40474690 GGGGATACAGTAGTGACTGAAGG + Intronic
1183983666 22:41557541-41557563 AGCCAGAGAGCAGTGAATGAAGG - Intergenic
1184128091 22:42501544-42501566 AGGGAGAGATAAGGGGCTCAGGG + Intergenic
1184350696 22:43941892-43941914 AGGGAGAACGAAGAGCCTGAAGG + Intronic
1184456686 22:44614886-44614908 AGGGAGAGAGAGGAGCATGAAGG - Intergenic
1184469830 22:44690171-44690193 AGGGAGAGAGAAGACCCTGTGGG + Intronic
1185133598 22:49055773-49055795 AAGGAGAGAGAAGGGAGGGATGG - Intergenic
949269610 3:2199394-2199416 AGGGGGAGAGAAGGTACGGAGGG - Intronic
949963629 3:9336209-9336231 AGGGAGAGAGAAGAGAGGGAGGG - Intronic
950050922 3:9988839-9988861 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950058011 3:10043956-10043978 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950094321 3:10319916-10319938 AGAGAGAGAGAAGAGAGGGAGGG + Intronic
950139673 3:10606803-10606825 GGGGATACAGCAGTGACTGAGGG - Intronic
950189836 3:10969017-10969039 AGGGAGAGAAAAATGAAGGAAGG + Intergenic
950299187 3:11860602-11860624 AGAGAGAGAAGAGTGACTGGAGG - Intergenic
950485871 3:13273755-13273777 AGGGAGACAGAAGTCCCTGGAGG - Intergenic
950680472 3:14581671-14581693 AGAAAGAGAGAAGTGAATGATGG + Intergenic
950718378 3:14865497-14865519 CTGGAGAGAGAAGGGACTGAGGG - Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951125961 3:18983384-18983406 AGGGAGAGAGACATGATTGTGGG - Intergenic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951206850 3:19934397-19934419 AGGGAGAGAGAGGAGAGAGAAGG - Intronic
951338909 3:21459610-21459632 AGGGATTGAGAACTGATTGAGGG - Intronic
951624424 3:24644398-24644420 AGAGAGAGAGATTTGGCTGAAGG - Intergenic
952055840 3:29444638-29444660 AGGGAGAGAGAAGTTACATTTGG + Intronic
952200899 3:31126417-31126439 AGGGAGAGAAAAGGCACTTATGG + Intergenic
952532928 3:34280533-34280555 TGGCAGTGAGGAGTGACTGAAGG + Intergenic
953466013 3:43120121-43120143 AGGGAGTGAGAAGTGAGACAAGG + Intergenic
953774560 3:45804123-45804145 AGGGAGAGAGGAATGACTGACGG - Intergenic
953857233 3:46508722-46508744 AAGGAGATAGGAGTGACTTAGGG - Intergenic
953857311 3:46509345-46509367 AAGGAGATAGGAGTGACTTAGGG - Intergenic
953901808 3:46847755-46847777 TGGGGGAGAGAAGGGACTGTAGG + Intergenic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
955615198 3:60800158-60800180 AGGCAGAGAGAAGTGGGGGAAGG - Intronic
956318974 3:67974116-67974138 AGGTAGAGGAGAGTGACTGATGG - Intergenic
956750914 3:72343200-72343222 AGGCAGAGGGAAGGGCCTGAAGG - Intergenic
956825282 3:72992330-72992352 AGAGAGAGAGAAGGGAGGGAGGG - Intronic
957356526 3:79094929-79094951 AGGGAGAGAGGAGGGAGAGAGGG - Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957640126 3:82842664-82842686 AGGGAGAGAGAAAGGAAGGAAGG + Intergenic
957680846 3:83432410-83432432 GGGGTGAGAGAAGAGACAGAGGG - Intergenic
957760488 3:84548912-84548934 TGGGTGAGTGAAGGGACTGAGGG - Intergenic
957803927 3:85122096-85122118 AGGATGAGAGAGGTGACTGAAGG - Intronic
957851202 3:85809731-85809753 AGGGAGAGAGGAGGGAGGGAGGG - Intronic
957892451 3:86377809-86377831 AGGGAAGGAGATGTGACTGTGGG - Intergenic
959153692 3:102639911-102639933 AAGGACAGGGAAGTGACTGATGG + Intergenic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959630615 3:108503176-108503198 AGGTAGAAAGAAGAGTCTGAAGG - Intronic
960484410 3:118233869-118233891 CTGCAGAGAGAAGTGTCTGATGG + Intergenic
960552376 3:118990236-118990258 AGGGAGAGAGAATAGAGGGAGGG + Intronic
960851445 3:122059041-122059063 AGGCAGAGAGAAAAGACAGATGG + Intronic
960857394 3:122117200-122117222 AGTGAGAGAGAGGTGGATGAAGG - Intronic
961175867 3:124834599-124834621 AGAGAGAGAGAAGGGAAGGATGG + Intronic
961199453 3:125032718-125032740 AGACAGAGAGAAGTGATTGTAGG + Intronic
961225107 3:125237105-125237127 AGGGAGACTGAATTGACTGAAGG + Intronic
961254200 3:125533195-125533217 AGGGAGAGAGAAGGGAGGGAGGG - Intronic
961424453 3:126834204-126834226 GGGGACACAGAAGTGACTCAGGG + Intronic
961505305 3:127367063-127367085 GGGGAGGGGGAAGTGATTGATGG + Intergenic
962350497 3:134652303-134652325 ATGGAGTGACAAGTGACTGATGG + Intronic
962426207 3:135271335-135271357 AGGGAGTGAGAGGGGAGTGAGGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
963582716 3:147147178-147147200 GGGGTGAGTGAAGGGACTGAGGG + Intergenic
963778334 3:149462716-149462738 AGGGGGTGAGAAGGGCCTGAGGG + Intergenic
963960449 3:151303852-151303874 AGGGTGAGGGGAGTGCCTGAAGG + Intronic
964290173 3:155169857-155169879 GTGGAGAAAGAGGTGACTGATGG + Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
964719025 3:159753463-159753485 AGGGAGAGAAATGTCACTGATGG - Intronic
965150968 3:164974411-164974433 AGGGAGAGACAATTTCCTGATGG - Intergenic
965353153 3:167640772-167640794 AGGGAGAGAGAAGGAAATGGTGG + Intronic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965620462 3:170637807-170637829 TGAGAAAGAGAATTGACTGATGG - Intronic
965729299 3:171753821-171753843 AGGGAGAGAGAAGCGGTAGAAGG - Intronic
966266397 3:178049737-178049759 AAGGACAGAAAAGTGACTGATGG - Intergenic
966466908 3:180239304-180239326 AGGGAGAGAGAAGTCAGTCGAGG + Intergenic
967853396 3:194098640-194098662 AGGGAGGGAGAAAGGAATGAAGG + Intergenic
967903692 3:194483887-194483909 AGGGAGAGAGAAGGGAGAAAAGG + Intronic
968191149 3:196668355-196668377 AGAGAGAGAGAAATGAAGGAAGG + Intronic
968768028 4:2484758-2484780 TAGGACAGAGAGGTGACTGACGG - Intronic
969143464 4:5100312-5100334 AGGGAGGGAGAAGGGAGGGAGGG - Intronic
969436061 4:7190245-7190267 AGAGAGAGAGAAGGGAAGGAAGG - Intergenic
969682931 4:8653159-8653181 AGGGAAAGAGAGGGGAATGATGG - Intergenic
969978911 4:11133867-11133889 AGGGAGAGTTAGGTGAGTGAAGG - Intergenic
970102970 4:12546219-12546241 AGAGAGAGAGAAGTGAGAGATGG - Intergenic
970224561 4:13844135-13844157 AGGGAGAGAGATGGGAATGGAGG - Intergenic
970486352 4:16528688-16528710 AGGTATAGAGAAGTGCCTGGTGG + Intronic
970759492 4:19467171-19467193 AGGGAGGGAGAAGTTACACAGGG + Intergenic
970894518 4:21086884-21086906 AGGGAGAAAGAAGGGAGGGACGG - Intronic
971185037 4:24366938-24366960 AGGGAGAAATAAGTGACTTCAGG + Intergenic
971367776 4:25991422-25991444 AGTGTGAGAGAAGTGACTCTAGG + Intergenic
972049795 4:34715340-34715362 AGGGAGAGGGAAGGGAGAGAGGG - Intergenic
972729106 4:41775802-41775824 TGGGATAGAGAAGGGACTGATGG + Intergenic
972730533 4:41790291-41790313 AGCAAGAGAGAAGAGAGTGAAGG + Intergenic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
974015218 4:56643146-56643168 AGGAAGAGAGAAGTGCATGGAGG - Intergenic
974204741 4:58686750-58686772 AGTGAGTGAGTGGTGACTGAAGG - Intergenic
975718985 4:77232286-77232308 AGGGAGACAGAAGTGAGACAAGG + Intronic
976266778 4:83192586-83192608 AGGGAGAGAACAGGGGCTGAAGG + Intergenic
976398259 4:84581302-84581324 AGAGTGAGAGGAGTGACAGAGGG - Intergenic
976883366 4:89957716-89957738 AGGGAGAGAGAGGAGCATGAGGG + Intergenic
977685752 4:99845579-99845601 AGAGATAAAGAAGAGACTGAGGG - Intronic
977728081 4:100320836-100320858 AGAGAGAGAGAAAGGAATGAAGG - Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978963668 4:114715023-114715045 AGGGAGAGAGAATTATTTGAGGG - Intergenic
979109118 4:116728337-116728359 AAGTAGAAAGAATTGACTGAAGG - Intergenic
979406054 4:120311559-120311581 AGTGAGAGATAAGTGAATCATGG - Intergenic
979596430 4:122539998-122540020 AGGGAGAGAGAACTGTATAATGG + Intergenic
979913007 4:126394547-126394569 AGGAAGAGAGAAAGGAATGAAGG - Intergenic
980196515 4:129596095-129596117 AGGGAGTGGGGAGGGACTGAGGG + Intergenic
980233949 4:130079279-130079301 AGGTAGAGATAAGTGAATCATGG - Intergenic
980363601 4:131769334-131769356 AAGGAGAGAAAAATGACAGAAGG - Intergenic
980486045 4:133459106-133459128 ATGGAAAGAGAAGTGACCCAAGG + Intergenic
980552164 4:134352757-134352779 AGAGAGAGAGAAATGAAAGAAGG - Intergenic
980830328 4:138123803-138123825 AGAGAGAGAGAAGGGACTTTTGG + Intergenic
982199643 4:152947825-152947847 AGAGAGAGAGAAGGGAAGGATGG + Intronic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
983050046 4:163035421-163035443 AGGGAGATTGATGTGAATGAAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984150470 4:176123810-176123832 AGGGAGGGAAGAGGGACTGAAGG - Intronic
984352142 4:178608839-178608861 AGAGAGAGAGATGTAATTGAAGG + Intergenic
984837090 4:184032344-184032366 AGAGAGAGAGAAAAGACTGGAGG - Intergenic
985046449 4:185945826-185945848 CCGGAGTAAGAAGTGACTGATGG + Intronic
985208646 4:187568440-187568462 AGAGAGAGAGAAGGGATGGAGGG - Intergenic
985216161 4:187656527-187656549 AAGGAGAGAGAAGTGCATGCTGG + Intergenic
985341578 4:188960310-188960332 AAGGAGAAAGAAGTGAAGGATGG - Intergenic
985493076 5:190523-190545 AGACTGAGAGAAGTGAGTGACGG - Intergenic
985572317 5:654823-654845 AGGGAGGAAGAAGTGAGAGACGG - Intronic
985613576 5:905468-905490 AGGGAGTCTGAAGTGACTGAAGG - Intronic
985810175 5:2077220-2077242 AGAGAGAGAGAAGAGGTTGAGGG + Intergenic
985969448 5:3363547-3363569 AGGGAGAGAGACTTGAATCAAGG + Intergenic
986053297 5:4110290-4110312 AGGAAGAGAGAAGTTCCGGAAGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
986941960 5:12964363-12964385 AGGGAGAGAGCAGGAACTTAAGG + Intergenic
987163538 5:15170510-15170532 AGAGAGAGAGAAGGGAGGGAGGG - Intergenic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
988337539 5:29925964-29925986 AGTGGGAGAGAATTGAATGATGG + Intergenic
989135819 5:38153675-38153697 AGGAAGAGAGAAATGACTGGTGG + Intergenic
989520395 5:42393984-42394006 TGGGAGGGAGGAGTGAATGAAGG + Intergenic
989552056 5:42746904-42746926 AGGGAAAAAGAAATAACTGAAGG + Intergenic
989952976 5:50322830-50322852 AGCTAGAGAGAAGTCAATGATGG + Intergenic
989987450 5:50717858-50717880 AGGGAGAGAGAAGTGACTGATGG + Intronic
990606129 5:57411749-57411771 AGGTGGAGAGAAGTAAGTGATGG + Intergenic
990653917 5:57933791-57933813 AGAGAGAGAGAGGTCACCGAGGG + Intergenic
990820479 5:59834120-59834142 AGACAGAGAGAAGTGGCAGAGGG - Intronic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
990995840 5:61731566-61731588 AGGGAGAGAGGAGAGAGAGAAGG + Intronic
991023463 5:62005470-62005492 AGGGAAGGAGAGGGGACTGAAGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991519643 5:67481457-67481479 GGTGATAGAGGAGTGACTGATGG + Intergenic
991773656 5:70062815-70062837 AGAGAAAGAGAAGTGAAGGAAGG + Intronic
991852950 5:70938239-70938261 AGAGAAAGAGAAGTGAAGGAAGG + Intronic
991977301 5:72195993-72196015 AAGGAGAGAGAAGTCACCAAAGG + Exonic
992020556 5:72619713-72619735 GGGGACAGAGAAGTGAAAGAAGG + Intergenic
992916126 5:81454719-81454741 AGAGAGAGAGAATAGACAGAAGG + Intronic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993041895 5:82823981-82824003 AGGGTGAGAAAAGTGAGTGATGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993252514 5:85547858-85547880 AGGGAGAAGGAAGTGAGTGTAGG + Intergenic
993256985 5:85604471-85604493 AGGGAGGGAGCAGTGACGGTGGG + Intergenic
993276354 5:85864799-85864821 ATGGAGAGAGAATAGAATGATGG + Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993348098 5:86810374-86810396 AGGTAGGGTGAAGTGAATGAAGG + Intergenic
993870140 5:93243176-93243198 AGGGAGGGAGGAGTCACTGAAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
993940739 5:94055423-94055445 AGAGAGAGGCTAGTGACTGAAGG - Intronic
993995234 5:94714766-94714788 AAGGATAAAGAAGTGAGTGACGG - Exonic
994265520 5:97711445-97711467 AGGGAGAGAGAAATGGAGGAAGG - Intergenic
994330501 5:98499902-98499924 AGTGAGAGCAAAGTGACTGGTGG - Intergenic
994414028 5:99445026-99445048 AGGGAGAGAGAAGTTATGAATGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
994552534 5:101255794-101255816 AGGGAGAGAGAAGTGAGCGCTGG + Intergenic
994951115 5:106464603-106464625 AGGGATAGAGAAGAGAGAGAAGG - Intergenic
995216167 5:109597358-109597380 AGGGAGAGAGAAGGCAGAGAGGG + Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995367347 5:111377826-111377848 GGGAAGACAGAAGAGACTGAGGG + Intronic
995523076 5:113029172-113029194 AGGGAGAGAAAAGATACTAAAGG + Intronic
996021532 5:118595921-118595943 AGGCAGAGAGAAAAGAATGAAGG + Intergenic
996396214 5:123016731-123016753 AGGGAGGAAGAAGTGAAGGATGG + Intronic
996691554 5:126345826-126345848 AGGGAGTGAGAAGAGCCAGAAGG + Intergenic
996836692 5:127801472-127801494 AGGCAGAGAGAGGGGAGTGAGGG - Intergenic
996924831 5:128811980-128812002 AGAGAGAGAGAAATGAAGGAGGG - Intronic
997267736 5:132505915-132505937 AGGGAGAGAAAACTGTCTGTTGG + Intergenic
997610255 5:135210806-135210828 AGGGAGAGAGAAGAGTGTGTCGG - Intronic
997660879 5:135588674-135588696 AGGTAGAGAGGGGTGAGTGAAGG + Intergenic
997707297 5:135968512-135968534 AGTGAGAGAGAATTGAATCATGG + Intergenic
997726261 5:136122424-136122446 CAGGACAGAGAACTGACTGAAGG + Intergenic
998074137 5:139222522-139222544 AGGGAGAGAGAAGAGGATGTTGG - Intronic
998273758 5:140731954-140731976 AGTGTGAGAGAAGTGACTACAGG - Intergenic
998367564 5:141640837-141640859 GGGGAAGGAGAAGAGACTGAGGG - Exonic
998679923 5:144455604-144455626 ATGGAGAGAGTTGGGACTGAAGG + Intronic
998785391 5:145703346-145703368 AGGGAGAGCTAAGAGACAGAAGG - Intronic
998961990 5:147497885-147497907 AGAGAGAGAGAAGGGAAGGAAGG - Intronic
999072774 5:148765194-148765216 AGGGAGAGAGAAAGGAAGGAAGG - Intergenic
999263846 5:150253774-150253796 GGGGAGGGAGGAGTGGCTGATGG - Intronic
999367942 5:151035079-151035101 AGGGAGGGAGAAAAGACTGTCGG + Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
999751714 5:154632362-154632384 AGGGAGGGAGAAGGGAAAGAAGG - Intergenic
1000164120 5:158630717-158630739 TGGGAGTGAGAATTCACTGAAGG + Intergenic
1000210289 5:159101464-159101486 AGGGAGAGAGAAAGGAGAGAAGG + Intergenic
1000285736 5:159824767-159824789 AGGGAGAGAAAAGTGAGAGCAGG - Intergenic
1000977122 5:167777230-167777252 AAGGAGAGAGAAGACAGTGATGG + Intronic
1001151628 5:169233793-169233815 AGGGAGAGAAAAGGGAGGGAAGG - Intronic
1001250789 5:170145195-170145217 AGGGAAAGAGAAGGAACTCACGG - Intergenic
1001505552 5:172276736-172276758 AGGGGGAGAGAAGGGAGGGAGGG + Intronic
1001752440 5:174141958-174141980 AAGGAGACAGAGGAGACTGAGGG + Intronic
1001881335 5:175246782-175246804 AGGGAGGGAGAAAGGATTGATGG - Intergenic
1002201380 5:177530656-177530678 CCGGTGAGAGAAGTCACTGAGGG - Intronic
1003038023 6:2662040-2662062 TGGGAGAGAGGAATGACTGAAGG + Intergenic
1003516607 6:6823790-6823812 AGGGACAGACAAGAGACAGAGGG + Intergenic
1004197924 6:13522009-13522031 AGAGAGAGACAAGAGACTGGTGG + Intergenic
1004752844 6:18581594-18581616 AGAGAGAGAGAAGTGGGGGAGGG - Intergenic
1004762498 6:18684129-18684151 AGGGAGAAGAAAGTGAGTGAAGG - Intergenic
1005856662 6:29868031-29868053 AGGGAGAGGGAAGGGAGGGATGG - Intergenic
1006191197 6:32210678-32210700 GGAGAGACAGTAGTGACTGAGGG - Intronic
1006494809 6:34414681-34414703 AGGGCAAGAGAAATGAATGAAGG - Intronic
1006625931 6:35397797-35397819 AGGGAGATGGAAGTACCTGAGGG + Intronic
1006670174 6:35725498-35725520 TGGGAGAGAGAAAGGACTGGGGG + Intronic
1006888208 6:37400059-37400081 AGAGAGAGAGAAGGGAAGGAGGG - Intergenic
1007001903 6:38321314-38321336 AGGGAGAGAGGAGAGAAAGAAGG + Intronic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1007241073 6:40425571-40425593 AAGGGGAGAGAAGTCAATGAGGG - Intronic
1007261625 6:40568059-40568081 AGAGAGAGAGAAGAGAAGGAAGG - Intronic
1007301859 6:40873780-40873802 AAGAAGAAAGGAGTGACTGATGG + Intergenic
1007387030 6:41527198-41527220 AGGGGTAGAGAAGTGAATTAGGG - Intergenic
1007719757 6:43878110-43878132 AGGGAGAGAAAAGTGGGTCATGG + Intergenic
1007767064 6:44166881-44166903 AGGGGAAGAGAAGAGAGTGAAGG - Intronic
1008013102 6:46490203-46490225 AGGGAGAGAGAAGTGTGAGCTGG + Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1009194134 6:60664533-60664555 AGGGAGAGAGAAGTCTAAGAGGG + Intergenic
1009397161 6:63212883-63212905 AAGGGGTGAGAAGTGGCTGAGGG - Exonic
1009596293 6:65740826-65740848 AGGAAGAGTGAAATGATTGATGG + Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009898729 6:69785092-69785114 TGGGGTAGAGAAGTGACTGGTGG - Intronic
1010069598 6:71727922-71727944 AGGTTGAGAGAAGTGTCAGAGGG - Intergenic
1010091071 6:71982700-71982722 TGGGAGTGAGAACTGACAGAAGG - Intronic
1011195706 6:84777204-84777226 TGGGAGAGAGCAGTGAGTGCTGG + Intergenic
1011206662 6:84906451-84906473 AGAGAGAGAGAAGTCAGTAAAGG + Intergenic
1011253019 6:85392977-85392999 ATGGGGAGAGAAGTTGCTGAAGG + Intergenic
1011675997 6:89734706-89734728 AGAGAGAGAGAACTCCCTGATGG + Intronic
1011788408 6:90871300-90871322 AGGGTGAGAGAATGGAGTGAGGG - Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1013774353 6:113663066-113663088 TGGGAGAGAGAAGGGAGGGACGG + Intergenic
1014677042 6:124379352-124379374 AGGGAGAGAGAAAGGAGAGAAGG + Intronic
1014770949 6:125457802-125457824 AGGGAGAGATAATTGAATCATGG - Intergenic
1014785562 6:125614621-125614643 ATGGAGAGGGAAATGACTGTAGG - Intergenic
1014871691 6:126603862-126603884 AATGACAGAAAAGTGACTGATGG - Intergenic
1015096314 6:129417920-129417942 AGGGGAAGAGAGGTGGCTGAGGG + Intronic
1015480465 6:133702779-133702801 TGAGAGAGAGAAGTGCATGAAGG + Intergenic
1015506326 6:133992640-133992662 AGGGAGAGAGAAGAGAGTAAAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1015849033 6:137552481-137552503 AGAGAGAGAGAAGAGAGGGAAGG - Intergenic
1015998512 6:139018857-139018879 AGGGAGAGAGAGTTGTCTCATGG + Intergenic
1016086684 6:139923444-139923466 AGGGAGATAGCAGTGGCTGCAGG - Intergenic
1016609944 6:145977372-145977394 AGGGTGAGAGAACTGCCTGTTGG + Intergenic
1016694925 6:146982172-146982194 TGGGAGATAGGAGTGGCTGAGGG - Intergenic
1017210482 6:151850390-151850412 AGAGAGAGAGAAGAGAGAGAGGG + Intronic
1017218543 6:151938628-151938650 AGGGAGAGAGATGGTACAGAGGG - Intronic
1017285705 6:152673545-152673567 AGAGACAGAGAAGAGACTGATGG + Intergenic
1017320323 6:153084486-153084508 AGGGACAGAGAAGTGAGCAAAGG + Intronic
1017487708 6:154918299-154918321 AGGGATAGAGAAGTATTTGATGG + Intronic
1017650389 6:156576169-156576191 GGGGAGAGTGAAGTGAGTGTGGG + Intergenic
1018639000 6:165889879-165889901 AGGGAGGGAGGAGTGAGTGAGGG - Intronic
1018639035 6:165889997-165890019 AGGGAGTGAGGAGTGAGGGAGGG - Intronic
1018768668 6:166954083-166954105 AGGCAGAGTGATGTGACTGCAGG + Intronic
1019394480 7:809991-810013 TGAGAGAGAGAAGTGTGTGAAGG - Intergenic
1019493120 7:1324287-1324309 AGGGAGAGAGAAGAAACTCCTGG - Intergenic
1019925348 7:4188078-4188100 AGCGAGAGAGAATTGAATCATGG - Intronic
1020418391 7:7970358-7970380 AGGGAGAGAGGGAGGACTGAGGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1020576730 7:9941945-9941967 AGAGAGAGAGAAATGACTTATGG + Intergenic
1020861410 7:13496536-13496558 GGGTAGAGAGAAGTGAGTGATGG - Intergenic
1021488052 7:21188452-21188474 CAGGAAAGAGAAGTGACTGGGGG - Intergenic
1021576868 7:22112992-22113014 AGGTAGAGAGAGGTGGGTGAGGG + Intergenic
1022774618 7:33513070-33513092 TGGTAGAGCCAAGTGACTGAAGG - Intronic
1022925414 7:35051603-35051625 AGGAAGGGAGAAGTGAATCAAGG + Intergenic
1023123287 7:36930927-36930949 AGGAAGAGATAGGAGACTGAAGG - Intronic
1023257068 7:38322747-38322769 AGGGAGAGAGCAGTGAGGTAGGG + Intergenic
1023521300 7:41052671-41052693 AGGTAGAGACAAGGGGCTGAGGG - Intergenic
1023916928 7:44596878-44596900 AGAGAGAGAGAAGGGAGGGAGGG + Intergenic
1023993247 7:45143080-45143102 AGGGAGAAAGAAGTAAATAAAGG - Intergenic
1024115126 7:46185480-46185502 TGGGAGAGTGAAGTGACTCCAGG - Intergenic
1024210946 7:47203406-47203428 ATGGAAAAAAAAGTGACTGAGGG + Intergenic
1024263645 7:47590123-47590145 AGAGAGAGAGAGATGACAGAGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025083786 7:56006232-56006254 AGGGAGAGAGAAGAGAATGAAGG + Intergenic
1026284971 7:68955058-68955080 AGGGAGAGAGAAGGGAGAGAAGG + Intergenic
1026494139 7:70888137-70888159 AGGGAGAGAGAAGGGGGTGAGGG + Intergenic
1026525113 7:71146584-71146606 AGGGAGGGAGAAGGGAGGGAAGG - Intronic
1026571923 7:71538836-71538858 AGGGAGAGAGAAAGGAAGGAGGG + Intronic
1026680218 7:72460992-72461014 GGAGAGAGAGAAGTGAATCAGGG - Intergenic
1026837662 7:73649184-73649206 AGGGAGAGAGAAGGGGGAGAGGG - Intergenic
1026865038 7:73818466-73818488 AGGGAGAGAGAAAGGAAAGAAGG - Intronic
1027288716 7:76678239-76678261 AGGGAATGAGCAGTGGCTGAGGG + Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027686423 7:81284204-81284226 AGTGAGAGGGAAGAGACAGATGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028343068 7:89746420-89746442 AGGGAGAGACAAGCTCCTGACGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029410937 7:100410192-100410214 TGGGAGAGAGGAGAGGCTGAGGG - Intronic
1029478897 7:100801319-100801341 GGGGACAGAGAAGAGCCTGAGGG + Intergenic
1029628837 7:101737726-101737748 AGAGAGAGAGAAGGGAGGGAGGG + Intergenic
1029823431 7:103166301-103166323 AGGAAGGGAGAAGTGAATCAAGG + Intergenic
1030238796 7:107296150-107296172 AGGGAGAGAGAGGGGAGGGAGGG - Intronic
1030248229 7:107409852-107409874 AATGAGAGAGAAGAGACTGGAGG + Intronic
1030343285 7:108405150-108405172 AAGCAGAGAGAAGAGACTGTTGG + Intronic
1030464140 7:109878350-109878372 AAGGAGAGAGAAGGGGTTGAGGG - Intergenic
1030690572 7:112528455-112528477 AAGGGGAGTGAAATGACTGATGG - Intergenic
1030866337 7:114705372-114705394 AGCAGGAGAGAAGTGAGTGAGGG - Intergenic
1030925045 7:115441156-115441178 AGGGAGGGAGAGGAGACAGAAGG + Intergenic
1030987882 7:116263479-116263501 AGGGAGAGAAGAGTGGCTGAAGG - Intergenic
1031021763 7:116636217-116636239 GGGGAGGGAGAAGTGATTGTTGG - Intergenic
1031082760 7:117274509-117274531 AGGGACAGGGAAGTGACAGCAGG + Intergenic
1031119176 7:117701226-117701248 AGGGAGGGAGAATTGACTTGGGG + Intronic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1031915951 7:127563449-127563471 AGTGAGCCAGAAGTGACAGATGG + Intergenic
1032005965 7:128302185-128302207 AGGGAGAGAGCAGAGACAAATGG + Exonic
1032510325 7:132467079-132467101 AGGGACTGAGAAGTCACTGGTGG + Intronic
1033024660 7:137760646-137760668 AGGGAGAGAGGAGAGCCAGAAGG + Intronic
1033208865 7:139445500-139445522 AGGGAAGGAGAAGTGACAGGTGG + Intergenic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033804225 7:144936561-144936583 GTGGAAAGAGAAGTCACTGAAGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034415544 7:150962644-150962666 AGAGAGAGAGGAGTGACTGCTGG + Intronic
1034587298 7:152105931-152105953 AGGGGGAGAGCAGTGTATGATGG - Intronic
1034701512 7:153100084-153100106 AGGTAGAGAGAAATGAGAGAGGG - Intergenic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035075287 7:156173758-156173780 AGGGAGAGAGAGGAAACTGGAGG - Intergenic
1035221213 7:157407564-157407586 AGGGAGAGAGGAGAGACGAAGGG - Intronic
1035240352 7:157525069-157525091 AGACAGAGAGAAGAGACAGATGG + Intergenic
1035488544 7:159251986-159252008 AAGGACAGAGAAGTAACTGGTGG - Intergenic
1035496121 7:159328050-159328072 AGAAAGAGAGGAGAGACTGAAGG + Intergenic
1035671357 8:1420085-1420107 AGGAAGGGAAAAGGGACTGAAGG - Intergenic
1035672006 8:1425457-1425479 AGAAAGAAAGAAGTGTCTGATGG + Intergenic
1036126574 8:6068505-6068527 AGGGAGGGATAAATGACAGAGGG - Intergenic
1036225873 8:6957135-6957157 AGGGAGAGAAATGTTACAGATGG + Intergenic
1036401089 8:8409133-8409155 AGAGAGAGAGAAGAGAATGTAGG - Intergenic
1036571138 8:9980565-9980587 AGGGAGGGAGGAGGGATTGAGGG - Intergenic
1036674409 8:10818177-10818199 AGAGAGAGAGATGTGACTAATGG + Intronic
1037159612 8:15752212-15752234 AAGGAGAGAGGAGGGGCTGAGGG + Intronic
1037316436 8:17603900-17603922 AGAAAGAGAGAAGTGTTTGAAGG + Intronic
1037587393 8:20287599-20287621 AGAGAGAGAAGAGTGAGTGAAGG + Intronic
1037743758 8:21627510-21627532 AGAGTGAAAGAAGTCACTGAAGG + Intergenic
1037864482 8:22432419-22432441 AGAGAGAGAGAAGGGAGGGAAGG - Intronic
1038050624 8:23807136-23807158 AGACAGAGAGATGAGACTGAGGG + Intergenic
1038219200 8:25591688-25591710 AGGGAGAGAAAAAGGAATGAAGG - Intergenic
1038409062 8:27344166-27344188 GGGGAGAGAGAAGTGGGAGAGGG - Intronic
1038448492 8:27621592-27621614 ATGGATAGACAAGTGACAGAGGG - Intergenic
1038452464 8:27648838-27648860 AGGGAGAGAGAAGGAAAGGAGGG + Intronic
1040009757 8:42651655-42651677 AGGGGTTGTGAAGTGACTGAGGG + Intergenic
1040929994 8:52723551-52723573 AGGGACAGAATAGTGACTGTTGG - Intronic
1041251003 8:55934880-55934902 AGTGAGAAAGAGGTGTCTGAAGG - Intronic
1041261103 8:56021111-56021133 AGAGAGAGAGAAGCGAGAGAGGG + Intergenic
1041429466 8:57762864-57762886 AGGTAGAGAGAAGAGGATGAAGG + Intergenic
1041543115 8:59009291-59009313 AAGGAAAGAGAGGAGACTGAAGG - Intronic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1041971117 8:63743600-63743622 AGAGAAAGAGAAGCCACTGAGGG + Intergenic
1042366928 8:67947861-67947883 ATAGAGGGAGATGTGACTGAAGG - Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043374814 8:79636485-79636507 AGGGAGAGAGAGGAAACAGATGG - Intronic
1043730276 8:83669221-83669243 ACAGAGAGAAAAGTTACTGAAGG - Intergenic
1043819704 8:84847288-84847310 AGGCTGAGTGAAGTGACTGTGGG - Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1045012390 8:97969509-97969531 ATGGAGTGAGAAGAGAGTGAAGG + Intronic
1045172659 8:99687634-99687656 CGGGAGAGAGTAGTGATTGTGGG - Intronic
1045281448 8:100753169-100753191 AGGGAGAGAGAAAGGAAGGAAGG - Intergenic
1045281457 8:100753213-100753235 AGGGAGAGAGAAAGGAAGGAAGG - Intergenic
1045308950 8:100983995-100984017 AGAGAGAGAGAAGAGAGGGAAGG - Intergenic
1045491299 8:102671327-102671349 AGGGACAGAGAAGGGAGTGGAGG - Intergenic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1045720832 8:105108985-105109007 AGAGAGAGAGAAGAGAGAGAGGG - Intronic
1046507440 8:115154312-115154334 GGGGAGAGAGAAGGAACTCAAGG - Intergenic
1046723655 8:117651370-117651392 GGGGAGAGAGAGGGGACAGAGGG + Intergenic
1047050572 8:121107133-121107155 AGGGAAATAGAAATCACTGAAGG - Intergenic
1047096178 8:121628432-121628454 AGGGGGAGAGAAGGGAAGGAAGG + Intronic
1047496210 8:125410866-125410888 GGGGAGGGAGGAGTGGCTGAAGG + Intergenic
1047574336 8:126136343-126136365 GAGGAGAAAGAAGGGACTGAAGG - Intergenic
1047608949 8:126502028-126502050 TGAGAGAGAGAGGTGAGTGAAGG - Intergenic
1047627917 8:126676124-126676146 AGGGAGAGGTAACTGAATGATGG + Intergenic
1047799649 8:128295318-128295340 AGAGAGAGAGAAGAGAGAGAAGG + Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048593756 8:135845349-135845371 AAGCAGAGTGAAGAGACTGAGGG - Intergenic
1048646563 8:136427639-136427661 AGTGAGGGTGAAGTGACTGCTGG + Intergenic
1048982113 8:139708171-139708193 AGGGACAGTGAGGTGGCTGAAGG - Intergenic
1049038136 8:140092627-140092649 GGGGAAAGAGAAGTGCTTGAGGG - Intronic
1049143912 8:140983645-140983667 AGAGAGAGGGAAGTGAAGGAAGG + Intronic
1049356696 8:142192712-142192734 AGGGAGAGAGAAGAGTGAGAGGG + Intergenic
1050263527 9:3866289-3866311 AGGGAGCGAGAAGTCAATGAAGG + Intronic
1050337194 9:4601219-4601241 AGGAAGAAAGAAGGGAGTGAGGG - Intronic
1050680977 9:8111027-8111049 TGGGAGAGAGAAGGGACAGTAGG + Intergenic
1050869563 9:10550080-10550102 AAGAAGAGAAAAGTGACTTAAGG + Intronic
1051037114 9:12761684-12761706 AGGGAGAGAGAATTGAAGGAAGG + Intergenic
1051333193 9:16044045-16044067 AGTGAGAGATAAATGACCGAAGG - Intronic
1051388654 9:16539609-16539631 AGAGAGAGAGAAGGGAGGGAGGG + Intronic
1051388664 9:16539646-16539668 AGAGAGAGAGAAGGGAGGGAGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1051610964 9:18960905-18960927 AGAGTGAGAGAAGAGAGTGAGGG + Intronic
1052013836 9:23442700-23442722 AGGGAGAGAGGAGGGAAGGAAGG + Intergenic
1052452690 9:28652158-28652180 AGGGAGGGAGAAGTGAGAAAAGG - Intronic
1053147550 9:35722018-35722040 ATGGTGGGAGATGTGACTGAGGG + Intronic
1053329808 9:37193815-37193837 AGGGAGAAAGAAATTCCTGAAGG - Intronic
1053440576 9:38112915-38112937 AGGGAGACAGACGTGGGTGAGGG + Intergenic
1053627764 9:39893673-39893695 AAGGAGAGAAAAATGACAGAAGG - Intergenic
1053639044 9:40049989-40050011 AGGGAGAGGGATCTGTCTGAAGG + Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1053767035 9:41415122-41415144 AGGGAGAGGGATCTGTCTGAAGG - Intergenic
1053778232 9:41572345-41572367 AAGGAGAGAAAAATGACAGAAGG + Intergenic
1054216124 9:62357028-62357050 AAGGAGAGAAAAATGACAGAAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054319845 9:63646646-63646668 AGGGAGAGGGATCTGTCTGAAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054545701 9:66326629-66326651 AGGGAGAGGGATCTGTCTGAAGG - Intergenic
1054671357 9:67798314-67798336 AAGGAGAGAAAAATGACAGAAGG - Intergenic
1054790927 9:69255969-69255991 AGAGAGAGAGAAGGGAGGGAGGG - Intergenic
1055167393 9:73213406-73213428 AGAGAGAGAGAGATGACTGGTGG + Intergenic
1055181509 9:73393406-73393428 AGGGAGGCTGAAGTGACTGAAGG - Intergenic
1055769768 9:79704523-79704545 AGGCAGAGAGATGGGACAGAGGG - Intronic
1055961532 9:81825254-81825276 AGGGAGTGAGACTTGACTAATGG + Intergenic
1055977051 9:81965779-81965801 AGGGAGCAAGATGTGACTGTTGG + Intergenic
1056197521 9:84242438-84242460 AGAGAGAGAGAAGAGAGTGAAGG - Intergenic
1056266671 9:84903733-84903755 AGAGAGAGAGAAGGGAGGGAGGG - Intronic
1056418815 9:86403881-86403903 AAGGAGGAAGAAGAGACTGAAGG - Intergenic
1056508222 9:87277698-87277720 AGAGAGAGAGAAATAGCTGAAGG - Intergenic
1056865891 9:90227113-90227135 AGGGAAGGACAAGTGACGGAGGG + Intergenic
1057424008 9:94934254-94934276 AGGGAGAGGGAAGGGAGGGAGGG - Intronic
1057739371 9:97698406-97698428 AGGGAGAAAGAAGGATCTGAGGG - Intergenic
1057755505 9:97831825-97831847 AGGGAGAGAGAAGGGAGTAGAGG + Intergenic
1058052218 9:100418408-100418430 AGGGAGAGAGAAAAGAGGGAGGG - Intergenic
1058242236 9:102578844-102578866 AAGGAGTGACAAGTGAATGATGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058542761 9:106029288-106029310 GAGGAGAGGCAAGTGACTGAAGG - Intergenic
1058607800 9:106742302-106742324 AGGGAGAGAGATTTTCCTGATGG - Intergenic
1058668356 9:107340601-107340623 AGGGAGGGAGACCAGACTGAAGG - Intergenic
1058712578 9:107693694-107693716 CGGGAGAGAGAAGTGTTTTAGGG - Intergenic
1059357212 9:113709275-113709297 AGAGAGAGAGAATGGACTTAAGG + Intergenic
1059357232 9:113709439-113709461 AGGGAGAGAGAACTGTCAGCAGG + Intergenic
1059391913 9:114004587-114004609 AGGAAGGGAAAAGTGACGGAAGG - Intronic
1059396235 9:114035730-114035752 AGGGAGGGAGGAGTGAGGGAGGG - Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059776057 9:117476242-117476264 ATGGAGAGAAAAGTCACAGAAGG - Intergenic
1059780210 9:117518239-117518261 AGAGAGAGAGAATTGACTTCAGG - Intergenic
1060143555 9:121231743-121231765 AGAGAGAGAGAAGGGAAAGATGG + Intronic
1061061380 9:128252068-128252090 AGGGAAAGAGACGTGTCTAAAGG - Intronic
1061114986 9:128604444-128604466 AGGGAGAAACAGGTGACTGCTGG + Intronic
1061427974 9:130512683-130512705 AGGGACAAAGAAGTGAATGAGGG - Intergenic
1062388491 9:136324704-136324726 AGGGAGGGCTAAGTGACCGAGGG + Intergenic
1202786923 9_KI270719v1_random:33677-33699 AGGGAGAGGGATCTGTCTGAAGG + Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185932841 X:4222005-4222027 AGGTTGAAGGAAGTGACTGAAGG + Intergenic
1186017763 X:5217680-5217702 AGAGAGAGAGAAGGGAGTGCAGG + Intergenic
1186401287 X:9262332-9262354 GGGAAGCGAGAAGTGTCTGATGG + Intergenic
1186945880 X:14566883-14566905 AGAGAGAGAGAAGGGACCCATGG - Intronic
1187035810 X:15538121-15538143 AGAGAGAGAGAAGACACAGAGGG - Intronic
1187693909 X:21899175-21899197 AGAGAGAGAGAAATGACTTTTGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188539447 X:31233193-31233215 CAGGAGAGAGCAGTGACTGAAGG - Intronic
1188773125 X:34179027-34179049 AGGGAGAGGGATGTGAGTGTGGG - Intergenic
1188889817 X:35595908-35595930 AGGTAGAGATAAGTGAATCATGG + Intergenic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1189405609 X:40720355-40720377 AGGGAGAGAATAGTGACTGGGGG + Intronic
1189737027 X:44081843-44081865 AGAGAGAGAGAAGAGAGTGAGGG - Intergenic
1190762448 X:53447864-53447886 GGGGAGAGAGAAGGGAATGCAGG - Intergenic
1191151173 X:57222060-57222082 AGGCATAGATAGGTGACTGAGGG - Intergenic
1191663909 X:63678306-63678328 AGGGAGTCAGGAGTGAATGAGGG - Intronic
1191675715 X:63790313-63790335 AGGGGTAGAGGAGTGAATGAAGG + Intergenic
1191796472 X:65026737-65026759 AAGGATAGAGAAGTGTCTTATGG + Intronic
1192341160 X:70264404-70264426 AGGGAGAGGGAAGAAAATGAGGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1194018197 X:88652529-88652551 AGGTAGAGAGAATTGAATCATGG - Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194861978 X:99010705-99010727 AGGGAGGGAGAAGGGAAGGAAGG + Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195619759 X:106941401-106941423 AGAGAGAGAGACGTGAGGGAGGG + Exonic
1195765266 X:108289715-108289737 AGGGAGAGAGAAGTGAGTGCAGG - Intronic
1195815090 X:108876252-108876274 AAGGAAAGAGATGTGATTGAAGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196738389 X:119001212-119001234 AGGGAGAGAGGAGAGAGGGAGGG + Intronic
1197030595 X:121809192-121809214 AGGGACAGTGAAGTGAATGTGGG - Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197657597 X:129133937-129133959 AGGGAGAAAGTACTGACTGTAGG + Intergenic
1198199281 X:134399132-134399154 AGGAAGAGAGTAGTTCCTGAAGG + Intronic
1198451311 X:136768888-136768910 AGGGAGACAGGAGGGAATGAGGG + Intronic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1199277519 X:145963920-145963942 AGGGACAGCGTAGTGACTGAGGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199325311 X:146492217-146492239 AGGGAGAGATAATTGAATCATGG + Intergenic
1199364498 X:146963859-146963881 AGAGAGAGAGAAGTTTCTGATGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199978402 X:152907578-152907600 AGGGAGAAAGAAGGGGATGAAGG + Intergenic
1200134673 X:153869113-153869135 AGGCAGAGGGCAGTGTCTGAAGG - Intronic
1200404702 Y:2797940-2797962 AGTGAGTGAGTAGTGAGTGAAGG - Intergenic
1200920260 Y:8606866-8606888 AGGGAGAAAAAAGGGACTGGGGG + Intergenic
1201517627 Y:14835272-14835294 AGGGAGGATGAAGGGACTGAAGG + Intronic
1201550221 Y:15210990-15211012 AGGGAGAGAGAAATGAAGGAAGG + Intergenic
1201691706 Y:16774635-16774657 ACAGAGAGAGAAGTGAGAGAGGG + Intergenic
1201696187 Y:16829095-16829117 AAAGAGAGAGGAGAGACTGAGGG + Intergenic