ID: 989999638

View in Genome Browser
Species Human (GRCh38)
Location 5:50877876-50877898
Sequence ATCACAGAGCACCCTGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989999638_989999643 22 Left 989999638 5:50877876-50877898 CCTGGTCCAGGGTGCTCTGTGAT No data
Right 989999643 5:50877921-50877943 TGTCCCTGAGCAGATAACCAGGG No data
989999638_989999642 21 Left 989999638 5:50877876-50877898 CCTGGTCCAGGGTGCTCTGTGAT No data
Right 989999642 5:50877920-50877942 ATGTCCCTGAGCAGATAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989999638 Original CRISPR ATCACAGAGCACCCTGGACC AGG (reversed) Intergenic
No off target data available for this crispr