ID: 990003799

View in Genome Browser
Species Human (GRCh38)
Location 5:50922802-50922824
Sequence TGCACTGCAGGCAGCCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990003799_990003807 7 Left 990003799 5:50922802-50922824 CCCTCTGGGCTGCCTGCAGTGCA No data
Right 990003807 5:50922832-50922854 TCCAGCAGGGGGCAAGCGCCCGG No data
990003799_990003804 -5 Left 990003799 5:50922802-50922824 CCCTCTGGGCTGCCTGCAGTGCA No data
Right 990003804 5:50922820-50922842 GTGCACCGTGTGTCCAGCAGGGG No data
990003799_990003803 -6 Left 990003799 5:50922802-50922824 CCCTCTGGGCTGCCTGCAGTGCA No data
Right 990003803 5:50922819-50922841 AGTGCACCGTGTGTCCAGCAGGG No data
990003799_990003809 13 Left 990003799 5:50922802-50922824 CCCTCTGGGCTGCCTGCAGTGCA No data
Right 990003809 5:50922838-50922860 AGGGGGCAAGCGCCCGGCCCCGG No data
990003799_990003805 -4 Left 990003799 5:50922802-50922824 CCCTCTGGGCTGCCTGCAGTGCA No data
Right 990003805 5:50922821-50922843 TGCACCGTGTGTCCAGCAGGGGG No data
990003799_990003802 -7 Left 990003799 5:50922802-50922824 CCCTCTGGGCTGCCTGCAGTGCA No data
Right 990003802 5:50922818-50922840 CAGTGCACCGTGTGTCCAGCAGG No data
990003799_990003813 30 Left 990003799 5:50922802-50922824 CCCTCTGGGCTGCCTGCAGTGCA No data
Right 990003813 5:50922855-50922877 CCCCGGAGCCGCAGCCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990003799 Original CRISPR TGCACTGCAGGCAGCCCAGA GGG (reversed) Intergenic
No off target data available for this crispr