ID: 990007072

View in Genome Browser
Species Human (GRCh38)
Location 5:50956014-50956036
Sequence GAAGTGACATCCTTCAGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990007072_990007077 13 Left 990007072 5:50956014-50956036 CCGGTGCTGAAGGATGTCACTTC No data
Right 990007077 5:50956050-50956072 TATGACATGCCATCAAAGACTGG No data
990007072_990007078 14 Left 990007072 5:50956014-50956036 CCGGTGCTGAAGGATGTCACTTC No data
Right 990007078 5:50956051-50956073 ATGACATGCCATCAAAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990007072 Original CRISPR GAAGTGACATCCTTCAGCAC CGG (reversed) Intergenic
No off target data available for this crispr