ID: 990007074

View in Genome Browser
Species Human (GRCh38)
Location 5:50956036-50956058
Sequence CATGTCATATGGTTTCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990007074_990007077 -9 Left 990007074 5:50956036-50956058 CCTCCTGGAAACCATATGACATG No data
Right 990007077 5:50956050-50956072 TATGACATGCCATCAAAGACTGG No data
990007074_990007078 -8 Left 990007074 5:50956036-50956058 CCTCCTGGAAACCATATGACATG No data
Right 990007078 5:50956051-50956073 ATGACATGCCATCAAAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990007074 Original CRISPR CATGTCATATGGTTTCCAGG AGG (reversed) Intergenic
No off target data available for this crispr