ID: 990007077

View in Genome Browser
Species Human (GRCh38)
Location 5:50956050-50956072
Sequence TATGACATGCCATCAAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990007072_990007077 13 Left 990007072 5:50956014-50956036 CCGGTGCTGAAGGATGTCACTTC No data
Right 990007077 5:50956050-50956072 TATGACATGCCATCAAAGACTGG No data
990007074_990007077 -9 Left 990007074 5:50956036-50956058 CCTCCTGGAAACCATATGACATG No data
Right 990007077 5:50956050-50956072 TATGACATGCCATCAAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990007077 Original CRISPR TATGACATGCCATCAAAGAC TGG Intergenic
No off target data available for this crispr