ID: 990007103

View in Genome Browser
Species Human (GRCh38)
Location 5:50956329-50956351
Sequence CCATAAGGAATTAAAGAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990007099_990007103 -7 Left 990007099 5:50956313-50956335 CCACAGAGTGATAGGCCCATAAG No data
Right 990007103 5:50956329-50956351 CCATAAGGAATTAAAGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990007103 Original CRISPR CCATAAGGAATTAAAGAACG TGG Intergenic
No off target data available for this crispr