ID: 990016011

View in Genome Browser
Species Human (GRCh38)
Location 5:51063689-51063711
Sequence TCTCCCACAGGGAACTAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990016011_990016022 -9 Left 990016011 5:51063689-51063711 CCTGCCTAGTTCCCTGTGGGAGA No data
Right 990016022 5:51063703-51063725 TGTGGGAGAGGATGGGGGGGTGG No data
990016011_990016028 24 Left 990016011 5:51063689-51063711 CCTGCCTAGTTCCCTGTGGGAGA No data
Right 990016028 5:51063736-51063758 TGCTGCCATCACCACTGCTGCGG No data
990016011_990016027 1 Left 990016011 5:51063689-51063711 CCTGCCTAGTTCCCTGTGGGAGA No data
Right 990016027 5:51063713-51063735 GATGGGGGGGTGGAGGTTGGGGG No data
990016011_990016023 -6 Left 990016011 5:51063689-51063711 CCTGCCTAGTTCCCTGTGGGAGA No data
Right 990016023 5:51063706-51063728 GGGAGAGGATGGGGGGGTGGAGG No data
990016011_990016024 -2 Left 990016011 5:51063689-51063711 CCTGCCTAGTTCCCTGTGGGAGA No data
Right 990016024 5:51063710-51063732 GAGGATGGGGGGGTGGAGGTTGG No data
990016011_990016026 0 Left 990016011 5:51063689-51063711 CCTGCCTAGTTCCCTGTGGGAGA No data
Right 990016026 5:51063712-51063734 GGATGGGGGGGTGGAGGTTGGGG No data
990016011_990016025 -1 Left 990016011 5:51063689-51063711 CCTGCCTAGTTCCCTGTGGGAGA No data
Right 990016025 5:51063711-51063733 AGGATGGGGGGGTGGAGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990016011 Original CRISPR TCTCCCACAGGGAACTAGGC AGG (reversed) Intergenic
No off target data available for this crispr