ID: 990020117

View in Genome Browser
Species Human (GRCh38)
Location 5:51116403-51116425
Sequence TGTCCACTCAGGAGACCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990020113_990020117 23 Left 990020113 5:51116357-51116379 CCTGACTGTGTTTTATTTTTTAT No data
Right 990020117 5:51116403-51116425 TGTCCACTCAGGAGACCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990020117 Original CRISPR TGTCCACTCAGGAGACCTTC AGG Intergenic
No off target data available for this crispr