ID: 990020986

View in Genome Browser
Species Human (GRCh38)
Location 5:51127542-51127564
Sequence AAGAATACCCCAAAATGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990020984_990020986 -2 Left 990020984 5:51127521-51127543 CCAAGGGTGGGGTGCTGCTATAA No data
Right 990020986 5:51127542-51127564 AAGAATACCCCAAAATGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990020986 Original CRISPR AAGAATACCCCAAAATGGCC AGG Intergenic
No off target data available for this crispr